AGTTTGTATTTGTGTACATTTTGTAATTTGGGTTTGTTTTCTTCTTGGCAAACCGAATTACCACCGCAAATCGAACAACC GATACACCACGATGCATGTTGAAAAGAAATCAGAGCTTCGTAGCCTACTAAAATCCGGGGACAAGCGT
RACE-generated partial cDNA clones (not preserved as library); represent 5' ends.
Total RNA was isolated. Gene-specific 5' RLM-RACE (RNA Ligase Mediated Rapid Amplification of cDNA End) products were generated using the FirstChoice RLM-RACE procedure (Ambion). Vector sequences were removed and the RNA adapter sequence was used to determine the orientation of the clone and was removed from the sequence. Each sequence represents a potential transcription start site and is oriented along the direction of transcription.
Clones were not preserved and are not available for distribution.