Personal communication to FlyBase
Received from: Amy Kiger, Margaret Fuller
Department of Developmental Biology
Stanford University
Subject: Nup154 DNA sequence annotation
Date: Jan 10, 2000
> >First, I would like to include the positions of all of the P elements
> >that you mapped. I can't quite discern the exact insertion positions
> >from the 1999 Kiger et. al. Genetics paper. Could you possibly
> >provide these?
TTAGCAGAA (nup-6) GGCGGGAG (nup-4) C (nup-1) GTGGGTAC (nup-5)
ATTGAGCATCAGTCGACCAAATCTTCAGAT (tlp-1) TAG (tlp-2 and nup-3) TTT
The insert positions are shown in parentheses. There's a SalI site between
the nup-5 and tlp-1 insert positions, to orient you. Let me know if you
need more information.
> >Second, I would like to include the rescue fragment in the annotation.
> >>From the methods description it looks like the rescue fragment is a
> >PstI to XmaI genomic fragment which is said to include 857 bases
> >upstream and 648 bases downstream of the Nup154 gene. My problem is
> >that the nearest PstI site that I find in the sequence is about 400
> >bases further upstream than what I expected from that statement.
> >Perhaps there is a polymorphism in the sequence. If you could send me
> >additional info such as sequence from the 5' end of the rescue
> >fragment, that would be very helpful.
You caught an error in our manuscript. The first partial cDNA we isolated
extended about 400 bases further 5' than the one we confirmed by RACE and
reported in the paper. We erroneously reported the distance from the PstI
site to the 5' end of this different cDNA rather than the confirmed start
site. Instead, as you discovered, the distance is more like 1286 bp
upstream of the likely nup154 start site. Thanks for catching that.
> >Do you have any more information about the possible alternatively
> >spliced intron? It's interesting that it does not use a consensus
> >splice acceptor site.
No more information on the suspicious intron. It is possible that this
intron is an artifact of the cDNA we sequenced (with multiple coverage, so
we believe that was real). We felt it was fair to mention, however, since
we reported the \*complete* sequence of one full length cDNA (and it
happened to contain this difference from the partial cDNAs...).