Subject: another PC needed
Hello Beverley,
We cannot say to the nucleotide where the deletion begins or ends
because there are 3nt (AGG) repeated on each side. For purposes of
curation you could decide to arbitrarily assign any of those bases as
occurring before or after the deletion.
Here is where the deletion occurs relative to the codons you note below,
shown with the AGG upstream of the deletion (underscored):
wt
741 793
GlnGluGlyCysArgMetThr...ArgIleGlyThrValSerPro
CAGGAGGGCTGTCGCATGACA...CGGATAGGAACTGTGTCGCCT
\--- \---
N11
740 793
GlnGlu // ThrValSerPro
CAGGAGG // AACTGTGTCGCCT
\---
As a result of the deletion the frame is changed after Glu740. I leave
ThrValSerPro in the original frame above only so you can properly
identify the sequence.
Please let me know if this clears things up. Alternatively, you may
compare the wt sequence for aub exon 9 in X94613 to the N11 sequence in
AF334412.
\-Adam
\--
Adam N. Harris, Ph.D.
Technical Area Manager
Research & Development
Invitrogen Corporation
1600 Faraday Ave
Carlsbad, CA 92008
\-----Original Message-----
Sent: Tuesday, May 24, 2005  10:10  AM
To: Harris, Adam
Subject: Question about aubN11 allele
Dear Dr. Harris,
I am a curator for FlyBase and am in the process of curating the
molecular nature of the aub mutations that you reported in a 2001
Development paper, to appear in the genome maps in FlyBase.
I have a question about the aubN11 deletion. From your description,
there is a 154 base deletion beginning in codon G741, resulting
in a frameshift.
Here's the sequence around the start of the deletion. Can you tell me
the first base of the deletion so I can map the mutation accurately in
FlyBase?
wt
741
GlnGluGlyCysArgMetThr
CAGGAGGGCTGTCGCATGACA
Thanks in advance for any help you can offer. Your response will be
saved as a Personal Communication to FlyBase and used as a reference
for the mapping of the aubN11 mutation (in addition to your Development
paper).
Sincerely,
Beverley Matthews
FlyBase-Harvard