The Act5C promoter is fused upstream of a CaSSA reporter composed of the mCherry coding sequence in which the reading frame has been interrupted by inserting a CaSSA switch cassette that contains a target site for the 'gRNA#2' guide RNA (sequence of this guide RNA is GTACATCCATACAGTACCAG) flanked on each side by a direct repeat of part of the mCherry sequence. In addition, a stop codon has been inserted immediately upstream of the target site for 'gRNA#2'. Designed as part of the CaSSA system: if a double-strand break is induced using Cas9 and a source of the 'gRNA#2' guide RNA, strand annealing (SSA) repair can reconstitute a functional mCherry reporter tagged with Tag:CAAX(Unk).