Imprecise excision of the P-element, deleting most of the P-element sequence; 13bp of 5' inverted repeat and 17bp of the 3' inverted repeat remain, separated by the nucleotides CA. In addition, the 8bp target site duplication is present. This arrangement creates a stop codon downstream of the insertion site, and is predicted to encode a truncated protein of 340 amino acids.
CATGATGAAATAACATATGTTATTTCATCATGGTTCATAC
The P{}mei-41RT1 insertion is deleted in the mei-4199B strain leaving 40bp of mostly inverted repeat sequence inserted between the reported bases. This leads to a frameshift and early translation termination.
Heterozygotes are sensitive to methyl methanesulfonate compared to wild-type animals.