UAS regulatory sequences drive expression of an inverted repeat of f corresponding to a region amplified from genomic DNA with the primers CCTCGAGCGGCCGCTGATCTGATCTGCATCCACGTACACA and GGTACCGAATTCGATTCGCCTTGAGATACTGTACTGCCCAC.
viable, with Scer\GAL4Act5C.PI
viable, with Scer\GAL4T80
Expression of fdsRNA.Scer\UAS.fIR produces dsRNA which results in dsRNA interference (RNAi) of the f gene.
Expression of fdsRNA.Scer\UAS.fIR produces dsRNA which results in dsRNA interference (RNAi) of the f gene.