Four copies of a mutated 15bp region derived from the midline enhancer of Tl, containing a CNS midline enhancer element (ACGTG) is cloned into pH-Stinger, upstream of EGFP coding sequences. This construct differs from Avic\GFP4Toll.pH-Stinger as the sequences upstream of of the CNS midline enhancer element are changed to resemble a Sox site similar to that found in the wrapper sequence (AAATTTGTACGTGCCACAGA to CACAATGACGTGCCACAGA).