UASp regulatory sequences drive expression of the par-1 N1S isoform (amplified from the RE47050 cDNA clone), mutated to produce a kinase-deficient form of the protein (amino acids T408 and S412 have been mutated). The coding sequence is tagged at the N-terminal end with EGFP. Silent mutations have been introduced into the coding sequence (TAGTTAAATTGTTCCAAGTAA to TCGTCAAGCTATTTCAGGTTA) to render the construct resistant to RNAi mediated by P{TRiP.GL00253}.