A TI{CRIMIC.TG4.2} DNA cassette has been inserted into CG33090, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG33090 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.2} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG33090 : one targeted to a coding intron (GTCTTGTCCCTGGTGCTGGATGG) and the other to a non-coding exon in the 3' UTR (ATCTTTGGTTGTGTAGACTTCGG). The PCR check gave the expected-sized band for the right flank and no band for the left flank.