A TI{KozakGAL4} DNA cassette has been inserted into angel, replacing the coding sequence (coordinates of deleted sequence are 2R:23694021..23695096 , release 6 genome). This results in a simultaneous knock-out of angel plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of angel (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG30183 (angel is nested within an intron of CG30183). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GCAGATTTCTTTCCTCCACTCGG and ACTCACTGCCCTCAATCAACCGG.