UASt sequences are fused upstream of the EGFP coding sequence (including stop codon), followed by 10 repeats of a sequence (AAGCGAGAATCATACCCCTAGACCATTGAGCC, with each copy separated by a CGCG linker) that is complementary to "5'tsRNA[ProUGG]" a 5' tsRNA (tRNA-derived small RNA) fragment derived from tRNA[ProUGG]. This is designed to create a "sponge" to sequester 5'tsRNA[ProUGG] and knock-down its endogenous activity.