UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of three shRNAs that each target a different gene; the targets are skd (hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA), kto (hairpin contains an inverted repeat of CAGATGCTACGACAACGACAA) and CycC (hairpin contains an inverted repeat of CACGGCGACGGTTTACTTCAA).
CycCTH00601.S, Scer\GAL4ey.PU, ktoTH00601.S, skdTH00601.S has visible | adult stage phenotype
CycCTH00601.S, Scer\GAL4ey.PU, ktoTH00601.S, skdTH00601.S has decreased size | adult stage phenotype
CycCTH00601.S, Scer\GAL4ey.PU, ktoTH00601.S, skdTH00601.S has eye phenotype