UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of a short hairpin RNA (shRNA) that targets kto (the hairpin contains an inverted repeat of CAGATGCTACGACAACGACAA).
abnormal mitotic cell cycle | larval stage, with Scer\GAL4nub-AC-62
decreased size | adult stage, with Scer\GAL4ey.PU
visible | adult stage, with Scer\GAL4ap-md544
visible | adult stage, with Scer\GAL4ey.PU
eye, with Scer\GAL4ey.PU
wing, with Scer\GAL4ap-md544
wing blade, with Scer\GAL4ap-md544
wing disc | larval stage, with Scer\GAL4nub-AC-62