A TI{KozakGAL4} DNA cassette has been inserted into ao, replacing the coding sequence (coordinates of deleted sequence are 2L:10973471..10975215 , release 6 genome). This results in a simultaneous knock-out of ao plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of ao (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 63 bp downstream of the 3' end of the CG16743 gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTTCCCAGGATCTGTCAGAATGG and CATATATTTCATAATATAAAAGG.