GCACCAGGCCATTAAGTCTCTGATTTTGCTTACTTCCCTGCTGGGAATAAGCCTTGCAGCGGACTATTGTGCTCTGCCCA CGTGCCTGGACAAGCACATAGCCTGCAACAACAAGGGAAATTTCAGTGAAAATTGTCCCAAGGACGTGCGTGAGGTGAAG ATCGAGCCGGACCACAAACTGATACTGAATCTCTTAAACGAACTGCCCAACAATGTGGCTGGAGGCAAAA
Cloned cDNAs prepared from polyadenylated RNA isolated from young adult male testes, seminal vesicles, and ejaculatory ducts.
Adult male testes were dissected from 1-5 day old y[1] w[67c1] Drosophila melanogaster flies, after removal of the paragonia and inclusion of the ejaculatory ducts and seminal vesicles.
Poly(A)+ RNA was purified from dissected testis. The size fractionated cDNA (1-6kb) was directionally cloned in the Stratagene Uni-Zap XR vector using EcoRI and XhoI restriction sites. pBluescript SK (-) is produced after excision. The host strain is E.coli SOLR.