Open Close
General Information
Symbol
Dmel\GH13002
Species
D. melanogaster
Name
GH13002
FlyBase ID
FBcl0133581
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    GH_cDNA
    • GH cDNA library of D. melanogaster, iso-1 strain, adult head.
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      3' Sequence
      Total bases
      776
      NCBI
      3' sequence dataSequence Downloader
      ATATTCTTTCTGTAACTATTACCTATCTTTATTGGTGGACTTACAAAGGAGGATTCAAACTAGGGCTGTGGTTTTGTTGG
      GTCCAGTTCCGACTCCCCGGGAGTGCTTTGGGTTTCATTTCTACTGCCGTAATCTTTAGCAGGTCTGCGCTTTATGAATT
      CTGTATTGGAGGGCGCAGTCCGGAATGGTCCACGAGAAGTTGGCGTCGGAGCTGGAGCCGACCCTGATTTCTTTTTGCTT
      AAGGATTCTTGTCTTGTAGAAGGAGATATGCCGTCGTGAGAGGGTGAAGGTGACTTTCTAGACGGACTGCGGGAGGCCGA
      TGCCCTGGGAACTACACTCGGTGCTGGAGCAGAGCCCGATCTCTTCCAAGCTGACGGTGATGCGCCATCATATGCAGAAG
      CATCTGGTTCCCTATTTCGAGCAGCTGAATCTTCATCAACCAGATTAGGAGCTGGAGCCGAGCCGGACCGCTGCTTTCCA
      CCCCTTGGAGGTCTACTTGGCAGACTGATCAGTGGCTTACGGGGTGCTGGACCTGTAGGAGCTATAGACGCAGATGGAGA
      CGAATCGGATCTCTTTTTTCCTCCAGATTCGCCCTTACCTGGTGGCGGCGACGAACCGCCCTTTGGTGGAGCGGCTGGTG
      GCTTAGTACTGGGTTTCGATTGCGCATCCGCCTTGGCCTTTGCCTGCTGCTTCTTGATCCGATCCTCGATTCGCTTCTTG
      TTCTCCGGCGTCACGTCTCCGAAGATGCTTGTGATCAGGGCCTTGTACTCGTTGTA
      
      5' Sequence
      Total bases
      624
      NCBI
      5' sequence dataSequence Downloader
      CCTATCACGGACGACCGCCCAGCGCCTCGCCAGCGACGGGCAACAAGGTGCAGCACTACAACGAGTACAAGGCCCTGATC
      ACAAGCATCTTCGGAGAGCTGACGCCGGAGAACAAGAAGCGAATCGAGGATCGGATCAAGAAGCAGCAGGCAAAGGCCAA
      GGCGGATGCGCAATCGAAACCCAGTACTAAGCCACCAGCCGCTCCACCAAAGGGCGGTTCGTCGCCGCCACCAGGTAAGG
      GCGAATCTGGAGGAAAAAAGAGATCCGATTCGTCTCCATCTGCGTCTATAGCTCCTACAGGTCCAGCACCCCGTAAGCCA
      CTGATCAGTCTGCCAAGTAGACCTCCAAGGGGTGGAAAGCAGCGGTCCGGCTCGGCTCCAGCTCCTAATCTGGTTGATGA
      AGATTCAGCTGCTCGAAATAGGGAACCAGATGCTTCTGCATATGATGGCGCATCACCGTCAGCTTGGAAGAGATCGGGCT
      CTGCTCCAGCACCGAGTGTAGTTCCCAGGGCATCGGCCTCCCGCAGTCCGTCTAGAAAGTCACCTTCACCCTCTCACGAC
      GGCATATCTCCTTCTACAAGACAAGAATCCTTAAGCAAAAAGAAATCAGGGTCGGCTCCAGCTC
      
      Library Information (1)
      Library: GH_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from adult heads.

      Sample preparation

      Adult heads were collected from an isogenic y; cn bw sp (iso-1) strain.

      Protocol

      RNA from adult heads was poly(A)+ selected once. Oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid.

      Comment

      The GH library is separate from the HL library. Since many of the HL clones were not full length and others lacked inserts, a new adult head library was made.

      Reported As
      Symbol Synonyms
      References (1)
      Review (1)
      Rubin et al., 2000, Science 287(5461): 2222--2224
      A Drosophila complementary DNA resource. [FBrf0127297]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)