Open Close
General Information
Symbol
Dmel\RE62235
Species
D. melanogaster
Name
RE62235
FlyBase ID
FBcl0201166
Feature type
Computed gene(s)
 
Collection Status
BDGP
Known Problems
none
FlyBase assessment
    Library
    RE_cDNA
    • RE cap-trapped cDNA library of D. melanogaster, iso-1 strain, embryo (0-22 hr).
    Strain
      Vector
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      Full Length Sequence
      Total bases
      5,690
      NCBI
      Full Length sequence dataSequence Downloader
      CGATCTGCTTCTGTGGTATTTTTTGGGTACAATTCGGATATTGCATTGTTAATCTCGGTTTATTGAGTCCCAGTGGCCGT
      GATTTGTGCATCGACCAGTTGGAAGAGAGGGAGCAGTTGATCTGCGAATAGTTCCACGCGCTGGCACCCATAGTTTGTAT
      GCATTGCACTTAGTCTGGCGATCGGTTGGCGAGGCGAGAAACAACCTGTGGCAGCCAGCGGATGAGAACTGGATTCGATA
      GGAATCGACACGTTTGGACCGGACAGGATGAGCTGCTTTAGTGCGATGAGTGCCCCGCTGCTGGGCGAGATGGAGCAGAC
      CATTGGTATGCTGGAGCGCGGCACCATCGTGACCAAGTTGTATGGGAAACAGCGTCGTCCGGATCGCCGCCACCTGATGC
      TCATACGAGAGACACGACAGCTGCTCTGGGCAACGGTGGCCACACAAACGCCACGCACCGACTACGAGGGCGCCATACAG
      CTGCGGGAGATTCGCGAGATACGGGTGGGCAAGCACTCGAAGGAGTTTCGCCTGTTTGCCGACGACTGTCAGCGCTTCGA
      GTCCAGCAAGTGCTTTGTCATACTGCACGGCAATCACTTCAAGCTGAAGAGCTTCTCGGTGGTGGCTCTGTCGGAGATCG
      AGGCCGACAATTGGGTGCGGGGATTGCGTTACATGGTTAAGGACACACTGGGAGCACCCTATCCCTTGCAAATTGATCGC
      TGGCTGCGTCGCGAGTACTATCAAATCGAGAATGTTAACACGCATTCCGCCAAGGCCACGGAACAGTCGCCAGCCCAGGT
      GACCATTAAGGACTTTAAGCTCTTTTTGGCCGGAGTTAGCTGTAAGATGACCACCGGCAAGTTCATGGAGCACTTTACCG
      AGGATGTGCGGCGCAAGCACGATCTCAAGTTTGATGATTTCTCGCGGCTATATCAGAAGTTGCTGCTGCCCAACGGATTT
      GCCAGCGTCTTGTCCGGATCGGGAGTGGCCAACTTTCCCTATTCGGAGGACCAACAGGTGGTGCGACCGGCGGAGCTGAA
      GCAGTTCCTCGAGACGGAACAGCGCGATGTGAGCGCCAGTGAGATCAGTAGCGCAGCCATTGCCTCCTTCATTCGGGACT
      TTGTTCAGGACGTGGAACGTGATGTTCAGGAGCCGTATCTCACCTTCCCGGAGTTCGTCGACTTTCTGTTCTCCAAGCAA
      AACGACCTGTGGAACAGCAAGTACGACCAAGTGTTCATGGACATGAACCTGCCGTTGTCCTCCTACTGGATCGCATCGTC
      GCACAATACCTACCTGACGGGCGATCAGTTCTCCAGTGAATCCTCCTGCGAGGCCTACGCCCGCGCTCTTCGCATGGGCT
      GCCGTTGCATCGAGTTGGATTGTTGGAACGGGCCCGACAATCTGCCCTACATATTTCACGGCCACACCATTACCTCCAAG
      ATCAAGTTCATGGATGTCATCAAGACGATTAAGGATCATGCGTTCACCAGTTCCGAGTATCCGGTAATATTGTCCATAGA
      GCAGAATTGCTCCCTGGAACAGCAGCGGAATATGGCGCAGGCCTTGATCGAGGTTTTCGGGGATATGCTGCTTACGCAAC
      CTTGTGATCGAAACGAGCAGCACTTGCCATCGCCATACCAGTTGCGTCGCAAGATAATCCTGAAGCACAAGAAGTTGCCG
      CAGTTTGACGACATCGCGAATGGGATTTCTAGCACGGGTTCACTGGGCCATAGATCATCGTTGGGCGGAGCGGGCGGTGG
      AGCGCATGGGGAGAACGATGGCGAGAATGTGCGCAAGGTGTTCAAGGAGGGACTGCTCTACTTCAAGGATCCGGTCGATA
      AGTCCTGGAATCTTTATCAGTTCGTTCTGACCCATCAGGAGCTAATCTACTCCTCTGAGATCAACGAGTCACGCAACGGA
      AACTCCGAGGATGATGACTTTGGGCTTTCTTCGTCGTGCTCCCTAAACAGCAATATGCAGCAAAAGCAAAAGGATACCTC
      GGCCAACGATGAGCTGCACTTCGGCGAGAATTGGTTCCATGGGAAACTTGAAGGTGGCAGAAAGGAGGCTGATGATCTAC
      TAAAGAAGTACAAACACTTTGGCGATGGTACATTTTTGGTTCGGGAATCGGCCACGTTTGTGGGAGACTATAGCCTTTCG
      TTCTGGCGACGTAATCGCCCGAATCATTGCCGCATCAAGTTAAAGCATGAAAATGGATCGATCAAGTACTATCTAGTGGA
      GAATTTTGTATTCGATTCACTGTACTCACTGATCGTTTATTATCGCAAGAATATGCTGCGTAGCTCAGAGTTTTCGATTA
      TACTGAAAGAGCCAGTTCCGCAGCCGAAAAAGCACGAGGATCAGGAGTGGTTCCATCCGAACACCACCAAGGAGCAGGCC
      GAACAGGGTCTATACCGGCTGGAAATTGGTTCGTTTCTAGTGCGGCCATCGGTGCAGAGCATTAACGCTTTTGTCATTTC
      GTTCACAATCAATCGAAAGATCAAGCACTGTCGCATTATGCAGGAGGGACGCTTGTACGGCATCGATACAATGAACTTCG
      AGTCTCTGGTCTCGCTGATCAACTATTATACCCGAAATCCACTCTATCGCAATGTTAAGCTCAGCCATCCGGTGTCGCAG
      GAGCTGCTGCGTCAGGCGCTAGCGGAGGCGGCACAGGGTGATCATAGTGGCGGTCACGATGACAACGGTGCCTCCAACTA
      CATGGGCTCCAATCTGGAGGAGAATGTCACGTGCAAGGCGCTCTACAGCTATAAGGCGAACAAGCCAGACGAACTCTCTT
      TTCCCAAGCATGCCATCATAACGAATGTCCAGAGGGACAACTCGATGTGGTGGATTGGAGATTATGGTGGCATGATCAAG
      AAGCATCTGCCGGCAAACTACGTTAAGGTTATCGATTCAACTACCGAGGACTACAATTCGCTGAACGAAGAGGGCACGGA
      TGGACGCACCGATTCCATTGAGATTTTCGGAGCTGTTGCCTCGCTCTTTGAGTCCAACGATCCGGGGATTATTTTCAAGC
      TGCAGATACAAACGCCAACGATGCAGAATCCGTTTGTGATTGGCTTCGACAATCAGGAGACGGCGTACGAGTGGATAAAG
      GCAATCCAGGAGGCAGCCCTTATCGCCAGTCAGCTGGCATCGGAGAGGCGGAAAAAGGAGCGCACTGCCCGGGTGGCCAA
      GGAGATGTCCGATCTGATTATCTACTTCCGCAGCGTGCCGTTCCGCGAGCACTCGTGGATATTTCAGGAAATGTCGAGTT
      TCCCCGAAACGAAGGCCGAAAAGCAGTTCTTCCAGCAGAACACACAACTGTTTCTCTCCTACCATCGCAATCAGATTAGC
      CGAGTGTATCCGAAGGGTCAGCGCCTGGACTCGTCGAATTTTAATCCCATGCCATTCTGGAATGTTGGATCCCAGATGAT
      CGCACTGAACTATCAGACAGGCGATAAGGCCATGCAGCTGAATCAGGCCAAGTTTCGGAATAATGGACAATGTGGCTATA
      TCTTAAAGCCATCGTTCATGAAATCTGACAGCTTCAATCCGAACAATCCGCTGTGCGATGGCCTAAGCGAAGTTAAAGTT
      AGCATACGTCTGATAGCCGCACGTCATCTATTCCGGGGCGGCAAATCGAACAATCCGCAGATCGTGGTCGAATTGATTGG
      CGCTAGCTTTGATACGGGCGTTAAGTATCGCACCAAAGTCAATGAAAATGGTTTCAATCCGGTGTGGAATGAATCGTGCG
      AGTTTAACGTGCGTAATCCACAGTTTGCGATCCTTCGCTTCGAAGTGCAGGACGAGGATATGTTCGCCGAGACGCACTTC
      ATCGCCCAGGCGTGCTATCCGCTGACCTGCATTCGCCAGGGCTATCGCAGCGTCATCCTACGAAATAAGTTCAGCGAGGA
      GCTGGAATTATCGTCCCTGCTGATCAACATTAAGATAGCAAATGTTACCGCACCGTAAGAGGATTGCTGAGTTAGCTGGA
      TCAATATCAATGATTCCAAATCGAGTGTTTGCGAAAACAATTGCGCTAGATCAAAAGGAAAGCGAACTTAATTCGCAAAA
      GCAATTTATCAACAACTTGTACATAAGAACATTTCATCGAACTATGAACCTGATTCTCTCACTTGTAATTTGTCTAAAAA
      GCTTAGGATCTGAAACGTATGATTTAGATTTAGATTACTTTCTATACACATCAGCAGTTATGGTTAGTTCATACTATACA
      ATGAGTATTCAAATGGTAACAATGAATTCTGAACTCCTGGAACTGAAATCAAGTTTATGTAATCCGTATAATTTGTACAC
      TTTTCCATAACACTAAGCATTCAAGTCTGTTGTCCTCTAAATGTTGTATTTGTGCGTGAGATTGATTCAGGAGAATAGAA
      TGCTACGAATATGTTTTAACTATTCGTCACCTCATTATAAGCATAAGCAAACCAGATTTGATTTGATTTCGATTTAGGGA
      ACTTGAGCTATTTCCATTTTACCAGTTTTACCATCAAAAGTTAAGTACATTAAGTTGATTCCAAAATTAGAAATAGAAAC
      AATTCATAAACAGCTCAATTGGCATCAATTTAATGGGCATTTGATATTCAGTTTCAGGATCAGCTTTTCATAAGTATTAT
      ATTACAATCTTCTTAAAGACTTTTAACTGAAGAAAATAGACCACTTTCATATGTTATCTGGAAAACTATTTTAGACCTTT
      CTCTTAGCACAAATACTCAAACAGCATTTCAATCATTTAGCATTTACCTTTTTTATTTTCTCTTTTAAAGCTTAAAGTAA
      TAATACAATTTATAAAAAAAAAAGGGCAAAGGAAATTTAAACCACTTTGATTACATATGTCTTCCAGTTGTTTAACAATT
      ACGATATACCACATAATTGTGTCTATGTTATTTAACCACGATTGTTGTAGCTAATGTTACAAAAACTAAAAGTTTGCAAA
      CAATATTAAAATAAAATGTAATTATTCAATTACATTTAAATGAACGTGCCTTAAAATTCGAAATGATCGAAATTTTAAAT
      GTTTGAACGTTAACTATTGAAGTACACCTGTTGCTAAAATAACAAATATTTGAAAAATAATAATATAGCTCAAAGATATC
      TATTTTTTATAAAATCAAAGTTCTAACTTAGCTTCTTCTCTAAACTGCGAAATCTAAATATCTAAAGCCTAAGTTCAATA
      GACGTATTATTACTAAATGCATTATATAATTTATATATCTAGATATTCATAAAATGCACTAGTCGATTTAAGAAGTGGAA
      ATTGTGCTCCCTATGCGAATCATTTAGGATTTTAATCTGAAACTATTTGCATTCCATACGAATGCCCCACTGAAACGATC
      GATATCATTTGTCTTGCACTCGCATTTAATTATTTAACAAACATTCTGCTGTTTCCATTCGCACAATAGTTCTAATTTGG
      ACATTTTGCGCGTTTGAGCGCATTAGCAAATCATGCTTAGTATATATGTATGTGTATATGTACCCAAAATGTATTTCATT
      TGTACGTTCCGTTTTTAAGTGATTTGTATCTGTACGTCTAATAGATATTTTCAACTGTTTTTGTAATTGCCTTATAATTC
      AGTAAACACACACCATACGTATACATTCATAATTATTTAATGCCAAATAAATGTTTATCCGGCGTTAGCTGTCTAAAAAA
      AAAAAAAAAA
      
      Library Information (1)
      Library: RE_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from 0-22-hr embryos.

      Sample preparation

      For the RE cDNA library, embryos at 0-22 hr AEL were collected from an isogenic y; cn bw sp (iso-1) strain.

      Protocol

      RNA was polyA+ selected twice (RNA made by L. Hong). cDNA was synthesized by priming with the oligo(dT) primer adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95(2): 520-524; Carninci, P. et al. 1999. Methods Enzymol. 303: 19-44). Full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al. 1996. Genomics 37(3): 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al. 2001. Biotechniques 30(6): 1250-1254). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al. 2000. Genome Res. 10(10): 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, the cDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al. 2001. Genomics 77(1-2): 79-90). cDNAs were transformed into DH5-alpha TonA strain.

      Comment
      Reported As
      Symbol Synonyms
      RE_cDNA
      Riken embryo library
      References (3)
      Research paper (2)
      Hoskins et al., 2011, Genome Res. 21(2): 182--192
      Genome-wide analysis of promoter architecture in Drosophila melanogaster. [FBrf0213090]
      Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
      The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
      Supplementary material (1)
      Hoskins et al., 2011, Genome Res. 21(2):
      Supplemental Material. [FBrf0213251]
      External Crossreferences and Linkouts ( 1 )
      Linkouts
      DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)