Interaction in vitro; bait produced by in vitro translation; prey produced by in vitro translation.
The interaction of Bsg25A, Elba2 and Elba3 was assayed by the formation of a complex with a radiolabelled DNA fragment of the Fab-7 boundary element (TGCAGCGCCCAATAAGCAAATGGCAGC). The presence of each subunit was then confirmed by antibody supershift of the protein:DNA complex.