Subject: 35B Dear Mike, We have a P mutant that has a mitotic phenotype that is uncovered both by Df(2L)A220 35B01-02;35B09 and Df(2L)35B01-03;35BC04-05. The stock appears to have two insertions very close to one another. One at 35B and the other at 35C. The one we are interested is in 35B since that is lethal over Df(2L)A220 and has a mitotic phenotype. We cloned one side of the insertion at 35B by reverse PCR and have some 500 pb of sequence from a region some 1 kb away from the P-insertion. The reason why it is at some distance from the end of the P is complicated but we are sure that is the insertion site because it has internal P sequences as we expected from a very rough idea of the transposon and also by in situ using the cloned PCR product. These stocks were made by J.M.Dura but I have not been able to find him. Any way since we have the sequence I thought I could send you the P stock as well as the sequence to compare against the sequence that you have over the whole region. We have also isolated genomic clones and are in the process of screening a cDNA library. If the sequence matches somewhere in your sequence it would be great. It might even be possible to find right away what kind of gene is mutated. Can you do the search and let me know the results ?? Please let me know about all this and I will send you both the sequence by email and the p-stock. I cannot send you the seq at the moment because I am writing from home but I will do it tomorrow. Bye Claudio \****************** Dear Mike, The reference for the p-element at 35B is #1356 but is not in any stock center. It was part of a collection Kathy was going to throw away because they had not been characterized. The sequences I have are as follows: 31R CTAACATTCATTTAAATGAAAATCAACTTAAGTGACAGTTTTTTTTAGAA ACTTGGTCAGTTTTGTACGAGAATTTGCTAAATTATTCGATTTTTTATTG GAGTAGATTAAATACCGATTTTCTTTCTATTTCAAGTTTAACGATGTATC CTTTCTTTGAAAATTACTTGTATGCTTTACAAGATATTTATTTTTTTTAT AATTTAGTTTTAATCTAATCGGTCAGTCGCAACGCCAAAACCACACCCAC TATTTAAAGGTGCTAGTGTTTCATTGTCCACTTTAAAGTGTTACA 31UP CGAATTCACACAGACAGACATACAGAGGCGCACGATGGTGCAGGGAAAAT TCAATTAGTACAAATTGCCGTGGAGATTATCGGAAAATCATATCAAANCC GCAAGCAATGCAAGCTTTGTTAATTTTCTGTAATTAATTTAATTATTTTC ATTGCGGACTGGACCGNCTCGCTTGCTCAATTTGCGGGCAGTCGAGTGTG AAGGATTCGCATTTGGCCGGCAGTCGTCCGCTTGAAGATCNCACCGCTAA AAGCAA These sequences are some 1100 bp from one of the ends of the insertion but I do not know the orientation with respect to the chromocenter. Let me know what you find out. bye Claudio \****************** This was passed from Michael to John Roote. John Roote wrote to Claudio Sunkel stating that several genes fail to complement Df(2L)A220 and if Claudio sent the P stock they could test which of the genes it is. \****************** Subject: 35B insertion Dear John, Thank you for the information. However, last week we finally sequenced part of a cDNA clone and we found that the insertion must be very close to Su(H) so it is very likely that it is an allele of Su(H). Please keep the stock and if any body needs the cDNA they can have it. I will not continue working on this mutant. bye Claudio \****************** John Roote also wrote to J.M. Dura asking for more information concerning the P-element insertion mutation at 35B. Part of his reply: This is a complete 10.5 kb EcoR1-Kpn1 white+ genomic DNA fragment cloned into Carnegie 3. The mutator element was P<up>w-D1 X6</up> (19DE), a derivative of stock 9.3 - see Delattre et al. 1995 Genetics 141:1407-1424 . \****************** Query to Kathy Part of her reply: The stock was from Dura, Bloomington stock number 1356, unlocalised, inherited from HHMI, Dura called it M28/CyO.