Subject: Re: EP sequence
                      RE>EP sequence                               4/4/98
Dear Lynn
I've indicated below answers/comments about the EP sequence.  I can also fax
you a handdrawn detailed map of the plasmid if you'd like.  
Segment 1: OK: the 5'end of P{CaSpeR-4}, including the white gene. (We have
this sequence.)
P: OK
Segment 2: OK: the CaSper-4 polylinker up to (and including) the NotI site.
(We have this sequence.) 
P: OK
Segment 3: ? My guess: the pHSS7 sequences from P{PZ} and related
constructs;excised by NotI.  (We have this sequence.)
	   ? Which orientation is it in??
P: Yes, this is pHSS7.  Orientation is such that the Pst1 site in the kana
gene is 1.7 kb from the unique EcoR1 site in EP
(Segment 4: Starts with the CaSpeR-4 polylinker, picking up from NotI site.
	   ? How far does it go (what did you use to cut the enhancer
	        segment out of pBluescript?)
	   ? Need details on ligation to GAGA-UAS sequences; where you put
		the StyI site in pBluescript, etc.
Segment 5: ? Constructed enhancer )
P: The "enhancer" in EP starts from the NotI site (so no return to pCasper
polylinker) and contains both GAGA sites and thereafter Gal4 sites.  It ends
in Sal1, which is then joined to  XhoI in the next segment.  In detail:
GCGGCCGCTCTAGCCCCCCTCGAATGTTCTCTCTCTTCTCTTCTCTCTCTCTTTCTCGAATGTTCTCTCTCTTCT
CTTCTCTCTCTCTTTCTCGAGGTCATCAAGCTTAGGCCTC(a-oligo)(b-oligo)(b-oligo)(b-oligo)
(a-oligo)(b-oligo)(a-oligo)GTCGAG
I've written the sequence as is, because the whole thing was made in an
(overly) complicated way - the last 6 nt are the Sal1/Xho1 junction
each a or b oligo has 2 Gal4 sites and spacer sequence:
a- oligo:CAAGGCGGAGTACTGTCCTCCGGGCTGGCGGAGTACTGTCCTCCGG 
b- oligo:CAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACG 
For the next segment (hsp70 promoter), the promoter fragment was first cloned
into another polylinker and then to pCasper thus adding a Kpn1 site upstream
and and a Bgl2 site downstream of the promoter before Pst1, Hind3 in pCasper
(at the 3'P end).  
The sequence goes: Sal1/Xho1 junction (see above)-
GGTACC(GAGAGAGCGCCGGAGTAT.....CAAGCAAAGTGAACACGTCG)AGATCT-Pst1
The sequence in the parenthesis is the hsp70 promoter which you have the
sequence for.
Segment 9: OK: the 3' end of P{CaSpeR-4}  (We have this sequence.)
P:  Yes, from the Pst1 site.
Going through a lot of old notebooks to refresh....  good to get it done.  Let
me know if you need more info. 
regards
Pernille Rorth