FB2026_02 , released June 18, 2026
Reference Report
Open Close
Reference
Citation
Mount, S. (2000.5). FlyBase error report on April 5, April 28 and May 12 2000. 
FlyBase ID
FBrf0128209
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
From: Stephen M Mount
Subject: RE: drosophila snRNAs (fwd)
Michael,
This is what I sent to Celera for the annotation. The Excel file is being
sent separately.
Steve
---------- Forwarded message ----------
This email contains, in the body of the text, NOT as attachments,
1) established Drosophila snRNA sequences for U1, U2, U4, U5 and U6
2) hypothetical Drosophila snRNA sequences for U4atac, U6atac and U12
3) updated versions of the summary files I sent yesterday
The latter includes the three additional U2 genes that were missing
yesterday.
You may want to correlate these with existing (published) snRNA genes
for U1, U2, U4 and U6.
Note also that I found U5 genes that have variant 3' termini and may not
be real genes at all.
I hope this does it for you. If not, feel free to contact me again.
Steve Mount
\##################################################
1) established Drosophila snRNA sequences for U1, U2, U4, U5 and U6
What follows are established Drosophila snRNA sequences; most are based on
RNA sequencing. U3 is not a spliceosomal RNA, and I did not investigate
it.
> U1 RNA ACCESSION   X04257
atacttacctggcgtagaggttaaccgtgatcacgaaggcggttcctccggagtgaggcttggccattgcacctcggctg
agttgacctctgcgattattcctaatgtgaataactcgtgcgtgtaatttttggtagccgggaatggcgttcgcgccgtc
ccga
>U2 RNA
atcgcttctcggccttatggctaagatcaaagtgtagtatctgttcttatcagcttaacatctgatagttcctccattgg
aggacaacaaatgttaaactgatttttggaatcagacggagtgctaggggcttgctccacctctgtcgcgggttggcccg
gtattgcagtaccgccgggatttcggcccaac
>U4 RNA ACCESSION   K03095
agcttagcgcagtggcaataccgtaaccaatgaagcctccctgaggtgcggttattgctagttgaaaactttaaccaacc
cacgccatgggacgtgaaataccgtccactacggcaatttttggaagcccttacgagggctaa
> U5 RNA.  ACCESSION   K03096
atactctggtttctcttcaatgtcgaataaatctttcgccttttactaaagatttccgtggagaggaacactctaagagt
ctaaaactaattttttagtcagtcttgtcgcaagactggggcca
> U6 RNA.  ACCESSION   X06669
gttcttgcttcggcagaacatatactaaaattggaacgatacagagaagattagcatggccccagcgcaaggatgacacg
caaaatcgtgaagcgttccacattttt
\##################################################
2) hypothetical Drosophila snRNA sequences for U4atac, U6atac and U12
What follows are HYPOTHETICAL Drosophila snRNA sequences; based on the
genomic sequence. I found these with blast searches using modified
parameters.
> hypothetical fly U4atac; What's depicted here is the region of
similariy; the actual RNA may extend beyond these nucleotides.
accttccttgtcttggggagcagaaatgttcaatgaacgtctagtgaggacattgctgctgacaccaatgatgacacccc
cgctcgccgatcgttcgcgattggagttcggaatttttgga
> hypothetical fly U6atac;
gtggtccaaacgtgttgtttggaaggagagcaagttagcactcccctagacaaggatggaacacataaacggtcggctag
gcacagacaaaagccgtccacaaattttt
> hypothetical fly U12 RNA; matches vertebrate U12 snRNA at both
ends. gtgcctcaaactaatgagtaaggaaaaccaatcagccttgctaatcgcttggcagtattggcttctaggcaggg
gggcgt
gtcccgcgccccttgaagctcaaatttttgcaagggcacaggtcgtcccctcctcctccgcgtgggtggcgttcggccga
gcgaaccggcgcctactttgcgtccggctagcgaggatctctgggtgccatcccacggctgggtgttgcgatctgccc
Support for U4atac:
 gb|AC013956.1|AC013956 Drosophila melanogaster, \*** SEQUENCING IN
PROGRESS \***, in ordered
            pieces
            Length = 65679
 Score = 52.1 bits (116), Expect = 5e-06
 Identities = 88/129 (68%), Gaps = 13/129 (10%)
 Strand = Plus / Minus
Query: 2    accatccttttcttggggttgcgctactgtccaatgagcgcatagtgagggcagtactgc
61
            ||| ||||| ||||||||  ||   | ||| |||||| ||  |||||||| || | ||||
Sbjct: 1325 accttccttgtcttgggga-gcagaaatgttcaatgaacgtctagtgaggacattgctgc
1267
Query: 62   taacgcc--tgaacaacacacccgcatcaactagagcttttgc---tttattttggtgca
116
            | || ||  || |  |||| ||||| ||  |  || | || ||   |  | || ||   |
Sbjct: 1266 tgacaccaatg-atgacacccccgc-tcgcc--gatcgttcgcgattggagttcgg---a
1214
Query: 117  atttttgga 125
            |||||||||
Sbjct: 1213 atttttgga 1205
\##################################################
3) updated versions of the summary files I sent yesterday
snRNA promoter hits:
AC018327.1C	taattcccaactagttctagttgcgccctcatggaaa 	U1-82.3	001
AC015109.1C	caattcccaactggttttagctgctcagccatggaaa 	U1-95.1	002
AC019896.1C	caattcccaactgcttctggccgtttgctcatggaag 	U2	003
AC019896.1C	gaattcccaactgcttctggccgtttggtcatggaag 	U2	004
AC015154.1C	taattcccaactggttctggctacttccctatggaga 	U1-95.2	005
AC015154.1C	aaattcccaaacagttctggcagatctctcaaggaga 	U1-95.3	006
AC017493.1C	taattcccaactgcttctggccatcagctcatggaaa 	U1-21.1	007
AC019965.1C	taattcccaaatggttctggccgtttgcccatcgaga 	U2	008
AC015392.1C	taattcccaactgctactggctgcgcttgcatggagt 	??	009
AC017832.1C	taattcccaaatggttctggcttgctgtgaatggaat 	U4-1	010
AC014745.1C	taattcccaactgcttctggcagcgccggcatggtat 	U4-2	011
AC019965.1C	tgattcccaacatgttcaagctcgttctaaatgatcg	U5	012
AC019603.1C	taattcccaacgtgttaaagcagtcactgaatagagt	U5 (RNA)	017
AC019905.1C	gaattcccaaaaagttctatcacagaacgaatctagg	U5	018
AC017727.1C	tgattcccaacacgttcaagcaatttcttagtggtac	U5	019
AC019732.1C	aaattcccaactccttctggccaacactgatcctaga	U5 var.	020
AC017832.1C	taattcccaagcggttctattcaatattgagtatgga	U5 var.	021
AC017832.1C	aaattcccaattccttctggccaatactgatcctaga	U5 var.	022
AC014181.1C	tgattcccaaccggttctggttgcatggccatgagtt	U12	013
AC018038.1C	tgattcccaagtacatattctgcaagagtacagtata	U6-1	014
AC018038.1C	taattctcaactgctctttcctgatgttgatcattta	U6-2	015
AC018038.1C	taattctcaacttctttttccagactcagttcgtata	U6-3	016
AC018217.1C	aaattcccaagttctttttccgcatggagtgcttata	U6atac	023
AC013956.1C	taattcccaactagtactggccacttttgcttgaggt	U4atac	024
AC017832.1C	taattcccaactgattttagctgcagtcgcatgaagt	U2	025
AC017832.1C	taattctcaactgattttagctgcagtcgcatgaagt	U2	026
AC019732.1C	taattcccaactggtcttggctgcagtcgcatcaagt	U2	027
Small nuclear RNA gene report.  2-28-00
I found 5 genes for U1, 6 genes for U2, 2 genes for U4, 7 genes for U5 (3
of which are quite divergent at the 3' end), 3 genes for U6, 1 gene for
U12, 1 gene for U6atac and 1 gene for U4atac.
Sequences for Drosophila U1, U2, U4, U5 and U6 RNAs were known. Finding
the genes for U4atac, U6atac and U12 absolutely required varying the blast
search parameters.  -r 10  -q -11  -W 7  -G 15  -E 4;  -r 7  -q -14  -W 7
-G 7  -E 3; and -r 4 -q -5 -W 8 -G 10  -E 2 were among the more
successfull parameter sets.
Details follow below. Unfortunately, I did these searches through GenBank,
and so I have GenBank accession numbers rather than Celera numbers.
That these are indeed snRNA genes is clear from their promoter
sequences. ALL of these genes have a characteristic snRNA promoter
properly placed upstream of the RNA, so I have a high confidence in
them. I do not mention U11 because I could not find anything that was
compelling; the nature of snRNA conservation is such that I could be
missing something.
U1 -- five genes, all of which were previously described:
gb|AC018327.1|AC018327  Drosophila melanogaster, \*** SEQUENC...   327
8e-89
	my 001; U1-82.3
gb|AC017493.1|AC017493  Drosophila melanogaster, \*** SEQUENC...   311
5e-84
	my 007; U1-21.1
gb|AC015109.1|AC015109  Drosophila melanogaster, \*** SEQUENC...   311
5e-84
	my 002; U1-95.1
gb|AC015154.1|AC015154  Drosophila melanogaster, \*** SEQUENC...   311
5e-84
	my 005; U1-95.2
	my 006; U1-95.3
Additional U1-related sequences at 82E: 82.1 and a pseudogene (82.2) are
missing.
Their absence may be a polymorphism (due to recombination); the published
sequences of the real genes, 82.1 and 82.3 are identical, and they were
known to be directly oriented on the phage clone.
Alternatively, the tandem repeat could have caused an assembly error.
U2 -- six genes and what it probably a pseudogene. I have yet to work out
the relationship between these genes and what was previously published.
gb|AC019896.1|AC019896  Drosophila melanogaster, \*** SEQUENC...   381
e-105
	2 genes (my 003, 004)
gb|AC019965.1|AC019965  Drosophila melanogaster, \*** SEQUENC...   373
e-102
gb|AC017832.1|AC017832  Drosophila melanogaster, \*** SEQUENC...   373
e-102
	2 genes (my 025, 026). There is also a U4 gene and two U5 genes in
this contig.
gb|AC019732.1|AC019732  Drosophila melanogaster, \*** SEQUENC...   365
e-100
gb|AC014977.1|AC014977  Drosophila melanogaster, \*** SEQUENC...    52
8e-06
	A pseudogene ?
U4 -- two genes, both previously published.
gb|AC017832.1|AC017832  Drosophila melanogaster, \*** SEQUENC...   297
6e-80
	my 010; U4-1. There are also two U2 genes and two U5 genes in this
contig.
gb|AC014745.1|AC014745  Drosophila melanogaster, \*** SEQUENC...   238
5e-62
	my 011; U4-2
U5 -- 4 genes and 3 variant genes
gb|AC019603.1|AC019603  Drosophila melanogaster, \*** SEQUENC...   143
2e-33
	This matches the published U5 RNA sequence for Drosophila U5. My
number 017.
gb|AC019965.1|AC019965  Drosophila melanogaster, \*** SEQUENC...   141
7e-33
	This differs from the published U5 RNA in the 3' end stem-loop.
	My number 017.
gb|AC019905.1|AC019905  Drosophila melanogaster, \*** SEQUENC...   139
3e-32
	This differs from the published U5 RNA in the 3' end stem-loop.
	My number 018.
gb|AC017727.1|AC017727  Drosophila melanogaster, \*** SEQUENC...   139
3e-32
	This differs from the published U5 RNA in the 3' end stem-loop.
	My number 019.
gb|AC019732.1|AC019732  Drosophila melanogaster, \*** SEQUENC...   137
1e-31
	This differs greatly from the published U5 RNA in the 3' end
stem-loop.
	My number 020.
gb|AC017832.1|AC017832  Drosophila melanogaster, \*** SEQUENC...   139
3e-32
	These two genes differ greatly from the published U5 RNA in the 3'
end stem-loop.
	My 021 and 022. There are also two U2 genes and a U4 gene in this
contig.
U6 -- 3 genes on a single contig. These were all previously described.
gb|AC018038.1|AC018038  Drosophila melanogaster, \*** SEQUENC...   212
2e-54
U11 -- MISSING! There is nothing in the genome that convincingly matches
U11. However, given the difficulty of finding highly divergent snRNAs,
this result is inconclusive. I tried hard, varying parameters and checking
all sites that match the snRNA promoter consensus, but I did not find any
convincing hits.
U12 -- 1 gene.
 gb|AC014181.1|AC014181
nucleotides 16743-16506 (238 nt.).
U6atac -- 1 gene.
gb|AC018217.1|AC018217  Drosophila melanogaster, \*** SEQUENC...    74
1e-12
U4atac -- 1 gene
gb|AC013956.1|AC013956  Drosophila melanogaster, \*** SEQUENC...    52
5e-06
\##################################################
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
From: Stephen M Mount
Michael,
You suggested that I send you a report of snRNA positions. Here it is!
I have not renamed ANYTHING. New genes have been named according to the
system used for the old names. Notes relevant to this are at the bottom,
below my assignments and above the reference RNA sequences.
It is interesting that there are three or four clusters of snRNA genes:
AE003639 at 34A -- three U2 genes and one U5 gene in 35 kb.
AE03664 at 38AB -- two U2, one U4, and two U5 genes in 6 kb.!!!
AE003501 at 14B -- a U2 gene and a U5 gene in 1 kb.
AE003604 and AE003603 at 82E -- two U1 genes and a U4atac gene some
unknown distance apart in beta heterochromatin.
\##################################################
On Sun, 2 Apr 2000, Michael Ashburner wrote:
> Steve
>
> All the tRNAs are are in the xml, since they are displayed on Genescene.
> Suzi might be able to provide a list with coordinates and (predicted)
> cytology.
>
> We might be able to give you some help in correlating existing snRNA
> genes with the Celera sequence. Aubrey can, I am sure, translate coordinates into
> approximate cytology and that might help.
>
> I would like to avoid, if at all possible, the naming of snRNA/tRNA genes from
> the Celera sequence independent of what FB has already.
>
> Michael
\##################################################
Gene name	Promoter sequence and spacing to RNA 	Accession
RNA location	
U1-21D	taattcccaactgcttctggccatcagctcatggaaa 24	AE003588
18,650	18,813
U1-82Ea	taattcccaactagttctagttgcgccctcatggaaa 24	 X53542
2,592	2,755
U1-82Ec	taattcccaactagttctagttgcgccctcatggaaa 24	AE003604
196,233	196,396
U1-95Ca	caattcccaactggttttagctgctcagccatggaaa 24	AE003745
55,799	55,636
U1-95Cb	taattcccaactggttctggctacttccctatggaga 24	AE003745
23,856	24,027
U1-95Cc	aaattcccaaacagttctggcagatctctcaaggaga 24	AE003745
22,328	22,491
U2-14B	taattcccaactggtcttggctgcagtcgcatcaagt 25	AE003501
221,890	222,081
U2-34ABa	caattcccaactgcttctggccgtttgctcatggaga 25	AE003639
91,282	91,091
U2-34ABb	gaattcccaactgcttctggccgtttggtcatggaga 25	AE003639
95,005	95,196
U2-34ABc	taattcccaaatggttctggccgtttgcccatcgaga 25	AE003639
123,728	123,537
U2-38ABa	taattcccaactgattttagctgcagtcgcatgaagt 25	AE003664
83,768	83,577
U2-38ABb	taattctcaactgattttagctgcagtcgcatgaagt 25	AE003664
80,609	80,821
U4-38AB	taattcccaaatggttctggcttgctgtgaatggaat 25	AE003664
78,697	78,838
U4-39B	taattcccaactgcttctggcagcgccggcatggtat 25	AE003669
203,879	203,737
U4-25F	taattctcaaaaggttttagcagactccgcatagaga 24	AE003610
126,856	127,003
U5-14B	aaattcccaactccttctggccaacactgatcctaga 26	AE003501
221,335	221,226
U5-23D	gaattcccaaaaagttctatcacagaacgaatctagg 25	AE003581
87,935	87,805
U5-34A	tgattcccaacatgttcaagctcgttctaaatgatcg 25	AE003639
124,015	124,141
U5-35D	tgattcccaacacgttcaagcaatttcttagtggtac 25	AE003648
179,845	179,720
U5-38ABa	taattcccaagcggttctattcaatattgagtatgga 24	AE003664
80,037	79,911
U5-38ABb	aaattcccaattccttctggccaatactgatcctaga 26	AE003664
84,377	84,503
U5-63BC	taattcccaacgtgttaaagcagtcactgaatagagt 24	AE003477
26,662	27684
U6-96Aa	tgattcccaagtacatattctgcaagagtacagtata 27	AE003748
102,469	102,574
U6-96Ab	taattctcaactgctctttcctgatgttgatcattta 26	AE003748
103,072	103,178
U6-96Ac	taattctcaacttctttttccagactcagttcgtata 26	        AE003748
103,595	103,701
U4atac-82E	taattcccaactagtactggccacttttgcttgaggt 21	AE003603
245,404	245,525
U6atac-29B	aaattcccaagttctttttccgcatggagtgcttata 26        AE003621
31,949 32,045
U12-73B	tgattcccaaccggttctggttgcatggccatgagtt 25	        AE003526
210,776 210,539
Notes:
U1-82Ea is not in the Celera sequence. That could be due to a strain
difference or to an error in sequence assembly (the U1-82Ea and U1-82Ec
genes are located nearby and are nearly identical <up>Lo & Mount. Nucleic
Acids Res. 18: 6971-6979</up>). However, it should be noted that U1-82Ea
encodes the variant U1b which differs from U1a by a single nucleotide and
is known to be expressed in Kc cells and Oregon R flies. U1-82Eb is a
pseudogene and so is not listed. It lies between U1-82Ea and U1-82Ec and
is also missing from the Celera sequence. U1-95Cc encodes the U1c variant.
I have used the term U4d for U4-25F to avoid confusion. The U4a, U4b and
U4c sequences published by Guthrie and Patterson (A.R. Genetics 1988) are
attributed to Kiss, unpublished, and the U4-38AB gene resembles both U4a
and U4c (sometimes one and sometimes another) at points where they differ.
No U5 gene entirely agrees with the published RNA sequence. Distances to
the are cap site are therefore approximate.
------------------------------------
RNA sequences (for confirmation):
>gi|174317|gb|K00787.1|DROUR1A D. melanogaster U1 small nuclear RNA
GATACTTACCTGGCGTAGAGGTTAACCGTGATCACGAAGGCGGTTCCTCCGGAGTGAGGCTTGGCCATTG
CACCTCGGCTGAGTTGACCTCTGCGATTATTCCTAATGTGAATAACTCGTGCGTGTAATTTTTGGTAGCC
GGGAATGGCGTTCGCGCCGTCCCGA
>U2 snRNA (from various)
atcgcttctcggccttatggctaagatcaaagtgtagtatctgttcttatcagcttaacatctgatagttcctccattgg
aggacaacaaatgttaaactcatttttggaatcagacggagtgctaggggcttgctccacctctgtcacgggttggcccg
gtattgcagtaccgccgggatttcggcccaac
>gi|174319|gb|K03095.1|DROUR4 D. melanogaster U4 small nuclear RNA
AGCTTAGCGCAGTGGCAATACCGTAACCAATGAAGCCTCCCTGAGGTGCGGTTATTGCTAGTTGAAAACT
TTAACCAACCCACGCCATGGGACGTGAAATACCGTCCACTACGGCAATTTTTGGAAGCCCTTACGAGGGC
TAA
>gi|174320|gb|K03096.1|DROUR5 D. melanogaster U5 small nuclear RNA, 3' end
ATACTCTGGTTTCTCTTCAATGTCGAATAAATCTTTCGCCTTTTACTAAAGATTTCCGTGGAGAGGAACA
CTCTAAGAGTCTAAAACTAATTTTTTAGTCAGTCTTGTCGCAAGACTGGGGCCA
>gi|8768|emb|X06669.1|DMU6 Drosophila melanogaster U6 snRNA
NGTTCTTGCTTCGGCAGAACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCAGCGCA
AGGATGACACGCAAAATCGTGAAGCGTTCCACATTTTT
> Drosophila U4atac  -- hypothetical
caataatgttataaataataaacaatttttaatttttagaaggaagtcaaaagtagagtgtaaatcgcttattacacttt
atttacaaacgatattttagtgtatgcaatatttcccttgc
> Drosophila U6atac  -- hypothetical
gtgttgtttggaaggagagcaagttagcactcccctagacaaggatggaacacataaacggtcggctaggcacagacaaa
agccgtccacaaatttt
> Drosophila U12  -- hypothetical
gtgcctcaaactaatgagtaaggaaaaccaatcagccttgctaatcgcttggcagtattggcttctaggcaggggggcgt
gtcccgcgccccttgaagctcaaatttttgcaagggcacaggtcgtcccctcctcctccgcgtgggtggcgttcggccga
gcgaaccggcgcctactttgcgtccggctagcgaggatctctgggtgccatcccacggctgggtgttgcgatctgccc
\##################################################
Relevant text from Mount and Salz (manuscript in preparation for a special
issue of the Journal of Cell Biology):
The Drosophila genome contains multiple copies of the 5 UsnRNAs found in
the major class of sliceosomes. We found five genes for U1, six genes for
U2, three genes for U4, seven genes for U5, and three genes for U6. With
the exception of U4-25F, and the U5 genes (which were previously known
only by in situ hybridization), these genes had been described previously
<up>Lo, 1990; Saba, 1986; Das, 1987; Alonso, 1984; Saluz, 1988</up>. The variant
U4-25F gene presumably escaped detection because the predicted RNA has
only 69% identity with the major form of fly U4 <up>Saba, 1986</up> and 68% with
human U4. This degree of divergence is therefore quite high (human and fly
U4 share 73% identity), yet the gene is likely to be functional because
the promoter is conserved and some of the variation includes compensatory
changes that allow formation of the conserved stem loop structures.
The Drosophila genome also contains a minor class, or U12, introns <up>Hall,
1994; Tarn, 1996</up> and is therefore likely to contain the U12-type
spliceosome. Identification of snRNAs for the U12-type spliceosomes was
difficult because they had not been described previously, and were
somewhat diverged. However, by modification of the standard parameters for
blastn (see Methods), it was possible to find one gene for U12, one gene
for U6atac and one gene for U4atac. These are almost certainly real genes,
as critical sequences are conserved. In addition, the highly conserved
snRNA promoter, including a 9/10 or perfect match to the PSE consensus
TAATTCCCAA approximate 52 nucleotides upstream of the start <up>Lo, 1990 \#19;
Jensen, 1998</up> is present in each case. No U11 gene was found. This may be
due to divergence beyond what can be detected by blastn searches. However,
it is striking that the one identified protein component unique to the
U11/U12 snRNP (and minor spliceosome), the U11 35 kd. subunit <up>Will, 1999
\#20</up> cannot be found either. In fact, the U11 snRNP may not be required
for splicing, as its role should be 5' splice site recognition, and the
highly conserved minor splice site consensus is also complementary to
U6atac snRNA. Thus, minor class 5 splice sites could be recognized by the
U6atac snRNA alone, or by an unknown protein that acts during the early
steps of splicing. This mechanism would be analogous to a situation seen
in vitro where certain vertebrate introns can be processed in the absence
of U1 snRNP if the 5 splice sites can be recognized by U6 snRNA
<up>Crispino,1996 \#21</up>.
\##################################################
From: Stephen M Mount
Subject: Re: snRNA report - some questions
Michael,
Sorry to take so long to reply. I had meant to go back and check all of
the obscure Flybase snRNA entries (most of which are based on poor data),
but I haven't finished yet, and I am about to fly to CA for Gerry's 50th.
What follows is as far as I got.
Steve
\##################################################
> Steve .. I am now updating the snRNAs in FB with your data.
> I have some questions, which I need answered before I actually
> pass the updates on to the database.
>
> 0. You made some other minor changes
> to the names (ie the cytologies) .. were these on the basis of new evidence ?
>
>  snRNA:U5:23DE  >  snRNA:U5:23D 
>  snRNA:U5:34AB  >  snRNA:U5:34A 
>  snRNA:U5:35EF  >  snRNA:U5:35D 
>  snRNA:U5:63A  >  snRNA:U5:63BC 
The old evidence was in situ hybridization, and I suspect that some if it
was fairly inaccurate (see below). The names I assigned were based
entirely on the sequence. Specifically, on interpolation between nearby
genes within that same sequence accession (e.g.  snRNA:U5:63BC  is near
'BtbVII,' which was assigned to 63B-C). I recognize that this has it's own
problems. In this case, the BtbVII is over 50 kb. to the right, and the
only mapped gene on the adjacent accession, Shab, ='CG1066,' 63A1-63A7,'
is 130 kb. in the other direction.
> 1.  snRNA:U2:39B . &  snRNA:U2:40AB .  FlyBase had these genes but with NO
> attached sequence. You have U2-38ABa and U2-38ABb. Do I assume one of
> them is the  U2:39B  gene & the other is the  U2:40AB  gene ?
Probably not. U2-38ABa and U2-38ABb are less than 3 kb. apart and would
not have been distinguished by the method used (in situ hybridization).
My response to the following questions is the same. The in situs in those
old papers were just not that good. Remember, snRNAs make short
probes. Your guess as to which is which is probably better than mine.
> 2. FB had these genes with these accession numbers. Not on your lists:
>  snRNA:U2:84Ca , X04247
>  snRNA:U2:84Cb , X04245, X04246
>
> 3. FB has  snRNA:U4:39B , AQ034021 .. is this your  U4:38AB 
>
> 4. FB has  snRNA:U4:40AB , no sequence .. is this your  U4:39B 
>
> 5. FB has  U5:39B  with no sequence data. Is this your  U5:38ABa  ?
>
> 6. FB has these:
>  snRNA:U2:84Ca , X04247
>  snRNA:U2:84Cb , X04245, X04246
>
> Not on your list
>
> 7. I think I asked you this before: Any idea what these are ?
>
> \*a snRNA-a
> \*z FBgn0003454
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26817
> \#
> \*a snRNA-b
> \*z FBgn0003455
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26818
> \#
> \*a snRNA-c
> \*z FBgn0003456
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26819
> \#
> \*a snRNA-d
> \*z FBgn0003457
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26820
> \#
> \*a  snRNA:K2a 
> \*z FBgn0016982
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
> \*a  snRNA:K2b 
> \*z FBgn0016981
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
> \*a  snRNA:K8 
> \*z FBgn0016980
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
> \*a  snRNA:K9 
> \*z FBgn0016979
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
>
> \*g is the sequence accession and \*x the reference
>
> Thanks for all the help.
>
> Michael
>
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference