Gene or accession: CG9390
DNA error at position 8017. Upstream nucleotides: ttgccctccctgaaacaatg
Substitution: base T should be C.
Comments: The current translation for AE003594; AAF51696.1 terminates after 10
amino acids. This
isoform of AcCoAS has also been sequenced by Russell et al, submitted 1994,
sequence
Z46786; CAA86738.1. This sequence continues for another 571 amino acids to
generate the
full length isoform. The C terminal 576 aa of the sequence from Russell
aligns with the
second isoform annotated by Celera AE003594; AAF51695.
I believe the different isoforms differ only at the N terminus due to
alternative exon
splicing, not due to premature termination of the sequence after 10 amino acids.