Subject: EP(2)0638 is inserted in CG8415 intron
The P element insertion in EP(2)0638 has been mapped by in situ
hybridization to 50E4-7. A BLAST of the 340 nt flanking sequence
shows that the 3' portion (beginning at nt 117) is a repetitive
sequence. This explains why the insertion has not been localized on
the genomic sequence on GeneSeen. However, the 5' portion of the
flanking sequence (1-117) shows significant sequence similarity to
only one segment of the genomic sequence and thus allows the
insertion to be mapped on the genomic sequence. The entire flanking
sequence aligns perfectly with the scaffold segment AE003815, as
shown below.
>gb|AE003815.2|AE003815 Drosophila melanogaster genomic scaffold
>142000013386047 section 28 of
52, complete sequence
Length = 240495
Score = 668 bits (337), Expect = 0.0
Identities = 337/337 (100%)
Strand = Plus / Plus
Query: 1 gcgccttatcaataaaaaacgcaaatttgtcgcacggcccgattggtcgatgcgatagaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92130 gcgccttatcaataaaaaacgcaaatttgtcgcacggcccgattggtcgatgcgatagaa 92189
Query: 61 acgaaactaaaagcggaattgacccgaaacgatatcgaatatccatggtcgtattgtaca 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92190 acgaaactaaaagcggaattgacccgaaacgatatcgaatatccatggtcgtattgtaca 92249
Query: 121 gttgcggtaacaataatagcaccataagcacatttcgtgtttggcccaccgtttctgtat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92250 gttgcggtaacaataatagcaccataagcacatttcgtgtttggcccaccgtttctgtat 92309
Query: 181 tttctaacactttttcatcatattgctgactaaacttaaatactacagtgatttgctcgt 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92310 tttctaacactttttcatcatattgctgactaaacttaaatactacagtgatttgctcgt 92369
Query: 241 gtgttttgagtcgttatcctgttgaaatgtccaaaccaacggcatttcatcctcggcata 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92370 gtgttttgagtcgttatcctgttgaaatgtccaaaccaacggcatttcatcctcggcata 92429
Query: 301 tggcagcatcagattttccaggatatctgtgtaaatg 337
|||||||||||||||||||||||||||||||||||||
Sbjct: 92430 tggcagcatcagattttccaggatatctgtgtaaatg 92466
I believe that this insertion position maps to the intron of CG8415.
The estimated cytogenetic location of this gene (50E6) is consistent
with the in situ localization of EP(2)0638. There are no other known
mutant alleles of CG8415, according to the FlyBase report.