Gene or accession: Ribonuclease P RNA
Release: 2
Missed gene
Comments: We have blasted the D.melanogaster database with conserved sequences
found in Ribonuclease P RNA subunit. This RNA has secondary structure
consistent with other eucaryal RNase P RNAs. Based on database sequence, we
have PCR amplified this gene from genomic DNA and it's sequence matched the
sequence in the database. We have not identified the exact 5' and 3' termini
of the gene. D. melanogaster RNase P RNA can be found in AE003777.1 position
55063-54764. Here is the sequence:
AGTCAGTTGCAAACTAGCATCTGGGGCCCACACAACGAGTATCTGATTACTCCACAAACCATTGCCCCGGGAAGGTCTG
AGAATCGGCCGAGCCAGCTGTTTGTTGCGGCTTCATTTCCCAGCAGGAAACCTGTGTGATTGCAGGGCGAAAGTACCAG
AAATCCTGCTACCAGGTGTTGCCGTTGCCCCCGGTGACCGCCGCCTGGTTGGCATTGAAACCTTTCGTGGCCAGCGTTT
TTAGTGCGATGTGCTTGCTGCCTCTAAGGCAGAACTCAATTCAGACTAATCTGTGACTGACT