Subject: FlyBase Help Mail
comments: To whom it may concern:
I recently downloaded your sequence for the UAS cloning vector pGaTB to compare to
sequence from our facility. There are some small discrepancies between my sequence and
yours: CGGATCCGCGAAAGCTAAGCAAATA (Flybase position 2855-2880) has been replaced
by GATCCTCTAGGGTACG (my sequence); and there are two small insertions flanking AAGCTT
(Flybase position 2916-2921) so it now sequences as CCCAAGCTTGAAG (my sequence).
Thanks for your help,
Matt Phillips