Subject: P{lacW}CoVa S011046
I have been working on the nuclear-encoded subunits of cytochrome c
oxidase, one of which is encoded by the gene CoVa. In the FlyBase
Report, the l(3)S011046 insertion is listed as an allele of CoVa, but
there was some ambiguity about its location in the reference
correspondence with Corrado Caggese.
Using PCR, I have independently confirmed Caggese's result that
l(3)S011046 is indeed located in the CG6946 location. Based on the
genomic sequence of that region, the flanking sequence submitted by
Peter Deak overlaps with CG6946 on one end, overlaps with CoVa on the
other end, and spans the 317 bp in between. The original insertion site
was reported to be at the CoVa end of the flanking sequence, but
Caggese's and my results show that the P-element is actually located at
the 24th nucleotide of the CG6946 gene.
It would be helpful if you could remove the l(3)S011046 listing as an
allele of CoVa, as it may be misleading to others like me who are
looking for alleles of this gene.
Please let me know if you have any questions.
Thanks,
Jayatri
\--
Jayatri Das
Ecology & Evolutionary Biology
M156 Guyot Hall
Princeton University
Princeton, NJ 08544-1003 USA
Subject: Re: P{lacW}CoVa S011046
Dear Jayatri,
Thank you for writing in about the S011046 insertion. I have looked at
the Release 3 annotation and discover (as suggested by the gbrowse view
of these two e.g. at
http://www.fruitfly.org/cgi-bin/annot/gbrowse?name= gene:CG14724 )
that CoVa and CG6946 overlap at the 5' end by more than 24bp, in fact
by 61bp. Thus the S011046 insertion seems to fall within both the
CoVa and the CG6946 transcription units. Of course it is possible that
the beginning of CG6946 (i.e. base pair 1) is not the same for you and
for the Release 3 annotation. If you could send me the first few 10s
of bps according to your mapping I can double check.
FlyBase curation defines as alleles those cases where an insertion maps
within a transcription unit. Thus S011046 is an allele of both CoVa
and CG6946. The insertion (FBti object) has to be named after one of
them and in this case it is
FBti0009814 == P{lacW}CoVaS011046
though it is linked to both alleles, CG6946S011046 and CoVaS011046.
Hope this helps explain the FlyBase data for S011046.
Best regards,
Rachel.
for FlyBase curators.
Subject: Re: P{lacW}CoVa S011046
Dear Rachel,
Thanks for your reply regarding the S011046 allele. According to my
experiments, the sequence 5' to the putative insertion site is
GACTTATTTTTCAGAGAGATTAATCAAATA; the sequence 3' to the putative insertion
site is GCACGCGTCAAGTTGAAGATGCAGTGTGAC (the 'flanking sequence'). I have not
confirmed this by direct sequencing, this is merely derived from a PCR
experiment to determine which end of the 'flanking sequence' was the
insertion site.
I was not aware of the RA transcript of the CoVa gene that apparently
overlaps with CG6946, as I think I was working off of a previous release.
However, I am still confused about where the 5' end of the CoVa transcription
unit is \-- although the annotation indicates an overlap, none of the three
Genbank sequences for CoVa (NG_000573, NM_057869, Y09065) overlap with
CG6946. Can you help clarify this discrepancy? Otherwise I will do a 5'
RACE experiment to determine experimentally the sequence of the 5' end of
CoVa and whether the P-element actually disrupts the transcription unit.
Thanks very much,
Jayatri
\--
Jayatri Das
Ecology & Evolutionary Biology
M156 Guyot Hall
Princeton University
Princeton, NJ 08544-1003 USA
Subject: Re: P{lacW}CoVa S011046
Dear Jayatri,
thanks for sending me the element flanking sequence. I have delved a
little (no, a lot!) and this is what I have found.
I used Gadfly to get the sequence of the longest CoVa and CG6946 transcripts.
I then used the BDGP BLAST against 'Celera/BDGP whole genome shotgun
sequence (Release 2) (NT)' for each sequence in turn. This produces
hits which give the coordinates for each with respect to segment
AE003963.
The longest CoVa transcript extends from 68276 (5' end) to 69225 (3' end) on
AE003963.
The longest CG6946 transcript extends from 68337 (5' end) to 64117 (3' end).
The P-element flanking sequence you sent me extends from 68188 to 68247.
Thus CoVa and CG6946 overlap by 61 bp, as we previously thought, but
the 5' of CG6946 must be different than where you thought it was when
you said 'my results show that the P-element is actually located at the
24th nucleotide of the CG6946 gene', since the insertion site is
actually 120 bp within the CG6946 gene, well clear of the CoVa
transcription unit. Having delved so deeply I have found that the 24bp
refers to LD29934, whose 5' end is at coordinate 68242 of AE003963,
well 3' of the current annotated 5' end of CG6946 at 68337.
I was gratified to find that the flanking sequences for the S011046
insertion sent in by you and Peter agree. In conclusion the insertion
actually maps within the CG6946 transcription unit and 58 or 59 base
pairs 5' of the CoVa transcription unit.
It was the Deak personal communication that allocated S011046 to CoVa,
on the basis of proximity to CoVa but he didn't know at the time that
the insertion site mapped within CG6946 (CG6946 was not annotated
at that time).
I will disentangle S011046 from the gene record for CoVa, thus all the
phenotypic data will be ascribed to effects on CG6946. Since some of
the effects may be due to the proximity of the insertion to CoVa this
may not actually represent the biological reality, but until we know
more (such as have results of rescue experiments and the like) we can
associate S011046 with CG6946 alone.
Hope this helps,
Rachel.