Subject: Re: FlyBase Query (cy1883)
Dear Chihiro,
The rescue construct is a genomic fragment containing the 5' intergenic
region and the transcribed region. Here is an excerpt from our paper
currently under review.
The genomic position of the amplified region of mnk is indicated in Figure
2. The oligonucleotides used for amplification were as follows: 523 bases 5'
to the start of transcription, GGCCTCTAGAAACGACGCCGCAATTTAGGGC; 72 bases 3'
to the end of transcription, GGCCGCGGCCGCTGAGCAATTTGCCCGCCTCCG. The
underlined sequences correspond to XbaI and NotI sites that were used to
clone the genomic fragment into the pCaSpeR-2 transformation vector.
Regards,
Mike Brodsky
> Dear Drs Therkauf and Brodsky,
>
> I'm currently curating:
>
> Takada et al., 2003, Cell 113(1): 87--99
>
> I have a quick question I was hoping you could answer for me.
>
> In this paper Takada et al. use a 'mnk-rescued' construct, which was
> obtained from M.H. Brodsky. Can you give me some more molecular
> details for this construct? Is it a genomic fragment, a mini-gene, or
> a promoter driven mnk cDNA?
>
> I'm happy to wait for Brodsky's own paper for full details, however, I
> need some details to minimally curate this allele, in order to ensure
> that it is tracked between both papers.
>
> Any new information you give us will be curated as a personal
> communication from you to FlyBase.
>
> Best wishes,
>
> Chihiro.
>
> \----------------------------------------------------------------------
> Chihiro Yamada.
>
> FlyBase (Cambridge), http://fly.ebi.ac. uk:7081 /
> \----------------------------------------------------------------------