Gene or accession: CG8874 Release: 3 Gene annotation error Gene CG8874 has incorrect exon/intron structure or translation start site. Comments: Hi, There is an inconsistency in the BDGP sequences. Transcript CG8874-RA has a small intron gtgcccaagatccagaagaaatcaaaggccatccgcaatacattccgctccaagttgctcaatttccagttgaag which is not present in the final sequence for BcDNA:RH14840 . My sequencing of RH14840, confirms that the intron is an error. thanks, Mike Murray