Subject: Feedback about EP(3)3236
comments: To whom it may concern:
I wanted to let you know of some recent results I got that calls into
question the reported insertion site of EP(3)3236. I am in the process of
mapping a mutation in the 95C region, so I ordered available P elements in
this region. To confirm their insertion sites, I designed primers that lie
w/in about 500bp of the reported insertion site. I purified genomic DNA from
this EP line and used my flanking primers (see below) along with primers
specific to the 5' and 3' P ends used for inverse PCR (Plac1 and Pry4,
respectively). I have used this to successfully confirm the insertion sites
of the following: EP(3)3135, EP(3)3572, EP(3)3285, EP(3)3283, and
P{SUPor-P}KG02255. I was unable to amplify on either side of the 3236 EP
element, though could generate a band using just the genomic primers with each
other (the genomic DNA was from a heterozygote). Please note that the forward
primer was purposely designed to fall outside of the opus{}1412 repeat region.
I got negative results in both possible orientations of the P element.
Genomic primers:
(forward) 3236F0 \- AGTTAATGCAGCTAACCGC
(reverse) 3236R0 \- ACTCGCAATCTGCATATTCC
When I do a pattern search using the flanking sequence reported for this
element, the 27-mer can be found at numerous sites in the genome, including 5
different sites in the 90s region of 3R. While it's possible the stock I
received was mislabeled or some other type explanation, I thought I should
caution you about positioning this EP element at 95C6 (as in the list of
'insertions by map position').
Let me know if any other information would be helpful.
Thanks,
Tina
realname: Tina Franklin-Dumont