Subject: incorrectly defined gene
Dear FlyBasers:
I would like to call your attention to two genes that are incorrectly
defined in FlyBase. They are CG15000 and CG15001.
These CGs really constitute one gene, as defined correctly by
Clements M, Duncan D, Milbrandt J (2003). Drosophila NAB (dNAB) is an
orphan transcriptional co-repressor required for correct CNS and eye
development. Dev Dyn.226(1): 67-81
I have verified their definition of that gene by partial sequencing
of the EST LP22227 of the BDGP. Please note the 5' sequence of this
EST, available from the BDGP database, covers CG15001, but the end of
that EST, by blast search, overlaps CG15000. I have now done a 3'
sequence of that EST, and its sequence runs all the way through the
3' UTR of CG15000, the downstream gene.
Below is my sequence using the proper primer for 3' sequence for that
EST: This shows the 3' reach of the combined CG15001 (upstream) and
CG15000 (downstream) sequence.
TTTTTTTTTTTTTTTTTAAAATTATTATAACTTTTTATTGNATAGCATAAATAATGATTTTATTACAGTGTTTTAGTAT
AGATCACAGNAGNACTACAAAATAATCGTTGTCTTAAAGCTCCTTAAATAAAGTTATGTTTTTAGACGATACTAATCTA
GTTGAATTGCACTGGAATCAAAACGATTTGGGTGTGGGTAACCCAATCTGGCACTACGAATGGCATCCATCCAATTTTC
TCCAGAACTAAGTCTCTGGNGAAGCAGCACTCCTCTTGAGCGCGAGCACCTCGTTCAAAGCGGGACTGAGTGCCAGGGC
GGGATTG
Sincerely,
Tom Brody
\--