Subject: Re: Or98b
Personal communication from Hugh Robertson, Kim Walden and Jaclyn Wegner
Information communicated: Status of Or98b gene in D.melanogaster,
sequencing of Or98b sequence from a number of D. melanogaster strains.
..
We tried sequencing PCR
products across the apparent single base deletion frameshift in the
sequenced melanogaster genome from several strains. For some wacky
reason OregonR would not amplify. In a strain called New Jersey we got
the frameshifted sequence back. In an Ives strain we got a messy
sequencing reaction and so went ahead and amplified from 12 individual
flies and sequenced. The result is a nice polymorphic situation. Six of
them are homozygous for the frameshift, three are heterozygous, and
three are homozygous for the intact allele, which has an A present to
encode a glutamine at the frameshift. So the intact sequence of that
region of the gene from some alleles in the Ives strain is below (lower
case is the next intron).
ATGTATGCCTACTGTTTCATTACGGCTGGCCTTTCGGCCTGCCTGATGTCCCCTCTATCCATGCTGATTAGCTACCAAC
GA
ACAGGTGAATTGCAGCCGGAATTTCCATTTCCCAGTGTgtaagaaaaagtactgcttaatatccagaatattaagataca
gtttctgcagATATCCCTGGGACAATATGAAGCTGTCCAACTACATCATTTCC
I therefore believe that in addition to the evidence that this gene is
intact in simulans, yakuba and pseudoobscura genome sequences, Or98b as
present in the sequenced melanogaster genome has to be annotated as a
pseudogene, but hopefully with some kind of note saying that it is
polymorphic with intact alleles present in the species.
..
Hugh