Subject: piggyBac insertion f07705
The piggyBac insertion f07705 (FBti0042690) was generated by Exelixis
Corp and reported to be inserted in the vicinity of the 5' end of
CG5003 on 3R. It was selected by Allan Spradling to be sent to the
Bloomington Stock Center and is on their current stock list (#
19097). It is annotated by FlyBase as an allele of CG5003. Joe
Carlson at LBNL reanalyzed all of the Exelixis sequence traces for
their collection of piggyBac's and P-elements and submitted the
flanks to GenBank that were above a minimum length and quality. He
did not submit any flanks for f07705, apparently because of the poor
sequence quality. I was curious about this insertion and BLASTed the
poor quality flanking sequences that I got from Joe's database.
The 5' flanking sequence is:
ttaaaggtatgttg
ggtaatattagaggaagATGCATCTCTTCGTAGATATGAATATTCCTAGT
AACAGTTTATCTCGGGATC
reading out from the piggyBac. When I BLAST this to Release 4.1
genomic sequence, the best alignment is a 40/49 match, beginning at
base 35, to a segment beginning at 3R: 23742286. This is 37 bp
uptream of CG5003. While this is the best alignment, it is not very
convincing.
The 3' flanking sequence is:
TTAATGCAACTGAAGTCCAAACTGCATACCACACACTCCTCCATAAGATT
GCCGCCATCCTAGGTATTTTTGTGCGC
reading out from the piggBac. When I BLAST this to Release 4.1
genomic sequence, the best alignment is a 71/77 match, beginning at
base 1, to a segment beginning at 2L: 13827718, which is within the
tam gene.
Taken together, these data suggest that this was a double insert line
at the time the flanking sequences were determined by Exelixis.
Perhaps this message should be made into a personal communication and
added as a reference to the record for the insertion and fly stock.
...Bob Levis
\--
\------------------------------------
Robert W. Levis, Ph.D.
Carnegie Institution of Washington
Department of Embryology
3520 San Martin Drive
Baltimore, MD 21218, U.S.A.
\------------------------------------