Subject: Modification to a mus312 allele mus312Z3997
Hi,
I was recently curating the mus312 gene with Javasean, and encountered
a problem with the allele mus312Z3997. It was reported as being Q718
to stop, but is actually Q689 to stop using mus312-PA as the reference.
I have a personal communication from Jeff Sekelsky explaining the
discrepancy.
Here is the email from Jim:
Hi Susan. I haven't looked at the annotation for this gene in awhile.
I see now that there are two alternatively spliced forms listed, which
differ by the inclusion of a small exon. Based on the EST sequences
I've looked at, there are two different spliced forms that BOTH have
the small exon. The next exon starts at one of two sites, which differ
from one another by 12 bp, explaining the 4 aa difference:
>gi|33589608|gb|BT010102|BT010102 Drosophila melanogaster GH15104 full insert
cDNA.
Query: 101
gacaaacccataGATGACTTTATagacctaacacaagagttcgatatggtagaatttaat 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1927
gacaaacccatagatgactttatagacctaacacaagagttcgatatggtagaatttaat 1986
>gi|25009784|gb|BT001310|BT001310 Drosophila melanogaster AT14041 full
insert cDNA.
Query: 113
GATGACTTTATagacctaacacaagagttcgatatggtagaatttaatgaatcaaagcct 172
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 550
gatgactttatagacctaacacaagagttcgatatggtagaatttaatgaatcaaagcct 609
We used the predicted translation product from the longest known cDNA
sequence, which has the small exon 5 and the exon 6 that is 12 bp
longer. The mutation in Z3997 is definitely in a Q residue. It changes
'acccagaac' (TQN) to 'accTagaac' (T*N). I see now that it should be
Q693. The sequence file that we have has 25 residues per line, which
probably explains why we were off by that number. Thanks for catching
this.
Jeff
Subject: Re: Modification to a mus312 allele mus312Z3997
Hi Rachel,
The allele is reported as Q693@ for the CDS that will hopefully exist
soon (mus312-PC) but is not yet in our database. It would be Q689@ for
mus312-PA and Q674@ for mus312-PB.
Susan.