FB2026_02 , released June 18, 2026
Reference Report
Open Close
Reference
Citation
Cook, K., Garton, R., Brown, A., Ward, M., Deal, J., Kaufman, T., Cook, K. (2010.5.6). Generating Y-linked X chromosome duplications for region 3F to 4D. 
FlyBase ID
FBrf0210802
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
Generating Y-linked X chromosome duplications for region 3F to 4D
Kim Cook, Russell Garton, Adam Brown, Megan Ward, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook
Bloomington Drosophila Stock Center
Indiana University
We have generated a set of Y-linked duplications of X chromosomal segments by irradiating an attached-XY with an inversion in the X chromosome. The progenitor C(1;Y)N12, In(1)BSC4, P{w+mC=3'.RS5+3.3'}BSC4 w1118, BS chromosome has the following form:
1Lt to 1B5|4D7 to 1B5|4D7 to X heterochromatin breakpoint distal of bb|YS to YL|BS
In(1)BSC4 is described in FBab0046069 and its construction was described in FBrf0209647. P{w+mC=3'.RS5+3.3'}BSC4  is associated with the distal inversion breakpoint.  
Large irradiation-induced deletions within this progenitor chromosome with one breakpoint within the inversion near the distal inversion breakpoint and one breakpoint in X heterochromatin or basal X euchromatin produce Dp(1;Y) chromosomes of the form:
1Lt to 1B5|4D7 to medial breakpoint|basal X breakpoint to X het breakpoint distal of bb|YS to YL|BS
The Dp(1;Y) chromosomes share the same distal 1Lt to 1B5 segment containing the yellow (y) gene. The medial segments of these Dp(1;Y) chromosomes share a common end derived from the inversion breakpoint at 4D7, but they extend different distances distally on the standard X map. The Dp(1;Y) chromosomes carry segments of different sizes from the base of the X.  The breakpoints typically lie in basal X heterochromatin, but they may lie in basal euchromatin.  Dp(1;Y) chromosomes with breakpoints in YS cannot be established in stock, because deletion of YS male fertility genes renders males sterile. The BS-marked tip of YL in C(1;Y)N12 carries a portion of the base of the X distal to bb.   From Comparative Genome Hybridization microarrays of chromosomes derived from C(1;Y)N12 performed by Eric Spana at Duke University, we determined that the distal breakpoint of the basal X segment lies between Release 5 coordinate  X:22228492  in fog and coordinate  X:22384175  in stnA and that genes proximal to stnA are duplicated. We could not determine the proximalmost extent of this segment, but the microarrays indicated that the duplicated segment extends at least to coordinate  X:22416503  in CG13865.  We saw no evidence for a large duplicated segment encompassing the BarH1 and BarH2 genes in 16A, but the resolution of the microarrays is not high enough to exclude the possibility of a small duplicated segment from the region.
We exposed C(1;Y)N12, In(1)BSC4, P{w+mC=3'.RS5+3.3'}BSC4 w1118, BS males lacking a free Y chromosome to ~4500 rads in a 137Cs irradiator and mated them to winscy females. Dp(1;Y) chromosomes were recovered in y+ w+ BS males. Stocks were established by crossing these males to winscy females.  12 independent Dp(1;Y) chromosomes were established in stocks from approximately 341,000  progeny screened. 
We maintained the isogenic background of the DrosDel transposon collection in generating the progenitor C(1;Y)N12, In(1)BSC4 chromosome and in all the Dp(1;Y) screen crosses.  Only the proximal regions of the X chromosome and the Y chromosome of C(1;Y)N12 were introduced from a different genetic background.  Fourth chromosomes were not tracked.  
The distal 1Lt to 1B5 segment shared by all these duplications extends proximally to Release 5 coordinate  X:387562 , the insertion site of P{RS3)CB-5805-3 used in the construction of In(1)BSC4.
The distal extents of the basal duplicated segments were determined by the positions of the proximal irradiation-induced breaks.  We did not map these breakpoints.  We cannot exclude the possibility that genes from the base of the X chromosome are present in the basal duplicated segments.
On the standard X map, the proximal end of all the duplicated medial segments lies at Release 5 coordinate X: 4825473..4825859, the insertion site of P{RS5}CG40685-SZ-3655 used in the construction of In(1)BSC4.
The distal extents of the medial segments were determined by the positions of the distal irradiation-induced breaks. We mapped these breakpoints to ~10 gene intervals defined by PCR primers using the following approach. Males carrying the new Dp(1;Y) chromosomes were crossed to females carrying a transposable element insertion positioned distal to P{RS5}CG40685-SZ-3655. Primers flanking the insertions sites of the transposable elements were used to amplify fragments from DNA isolated from male progeny. With short extension times, fragments are amplified only if the site of the transposable element insertion is present in the Dp(1;Y) chromosome.  Breakpoints were mapped to successively smaller intervals in iterative rounds of crosses and PCR amplifications. The following transposable elements and primer pairs were used in mapping:
Insertion: P{SUPor-P}ecKG09175
Forward primer: CCAGAACGCAGCACTATATCGAC ( X:3736678..3736700 )
Reverse primer: GGCCAACGTCTTCAGTGCGACG ( X:3737602..3737581 )
Insertion: P{Mae-UAS.6.11}Vap-33-1GG01069
Forward primer: CGCTTTCTATTGCCATCTCGCTCGATTGGC ( X:3843899..3843928 )
Reverse primer: GCGAGGGGGTTGCAAAAGAATGGGG ( X:3844623..3844599 )
Insertion: P{EPgy2}CG6379EY08403
Forward primer: GTTCTCATCGTCCGAAGGTTCGTCC ( X:3994648..3994672 )
Reverse primer: CTAGACCAAGTGTGGTATGCTCG ( X:3995304..3995282 )
Insertion: PBac{RB}GlcAT-Ie04384
Forward primer: CCACACTGGAGACGAAGAATATCG ( X:4025177..4025200 )
Reverse primer: GTGGCTTAATCCAGTTGGGGTCC ( X:4025778..4025756 )
Insertion: P{SUPor-P}KG00475
Forward primer: GGCTAAGCCAGTTTACAGGATCG ( X:4186834..4186856 )
Reverse primer: GTTATCCTCGTTAAGTGCGTTAACCAC ( X:4187481..4187455 )
Insertion: P{XP}bid05964
Forward primer: GAGTTCCATCTCGATTTAAGGTGGC ( X:4317564..4317588 )
Reverse primer: GCATCCTACTCTCATTCGCTCGCC ( X:4318287..4318264 )
Insertion: Mi{ET1}MB01991
Forward primer: GTTCTAAGGCACAGGTCAGGGC ( X:4478617..4478638 )
Reverse primer: GGTGATGACAGCAGACACCAGGC ( X:4479348..4479326 )
Insertion: P{EP}HLH4CG351
Forward primer: CTCAGTCAGAGCAGCTGGTGTCC ( X:4539074..4539096 )
Reverse primer: CCAACTTAACCGAAGTGTTCGATGG ( X:4539664..4539640 )
Insertion: P{SUPor-P}KG02802
Forward primer: CGACGCGAACTCGTTTCTCGCCG ( X:4573372..4573394 )
Reverse primer: CGCTTGTAAGGTGTTCACCACTTGCG ( X:4574098..4574073 )
Insertion: P{SUPor-P}KG06705
Forward primer: CGAATTAATGACGGTTGGGGTTCGC ( X:4698591..4698615 )
Reverse primer: CATCCAAAGGACCACCAAACTGC ( X:4699234..4699212 )
Insertion: P{EPgy2}CG6903EY08878
Forward primer: GTCCAATCCAGACGCTCGTCGCG ( X:4813070..4813092 )
Reverse primer: GGCATAGTGACCCTGATCGAGGTCG ( X:4813615..4813591 )
The  Dp(1;Y) chromosomes carry the following medial segments (Release 5 coordinates and predicted cytologies): 
Dp(1;Y)BSC158   X:3736678..3843899 ;4825473..4825859 (3F3-3F9;4D7)
Dp(1;Y)BSC159   X:3994648..4025177 ;4825473..4825859 (4A5-4B1;4D7)
Dp(1;Y)BSC160   X:4025177..4186834 ;4825473..4825859 (4B1-4B5;4D7)
Dp(1;Y)BSC161   X:4186834..4317564 ;4825473..4825859 (4B5-4C3;4D7)
Dp(1;Y)BSC162   X:4317564..4478617 ;4825473..4825859 (4C3-4C8;4D7)
Dp(1;Y)BSC163   X:4478617..4539074 ;4825473..4825859 (4C8-4C10;4D7)
Dp(1;Y)BSC164   X:4573372..4698591 ;4825473..4825859 (4C12-4D2;4D7)
Dp(1;Y)BSC165   X:4573372..4698591 ;4825473..4825859 (4C12-4D2;4D7)
Dp(1;Y)BSC166   X:4573372..4698591 ;4825473..4825859 (4C12-4D2;4D7)
Dp(1;Y)BSC167   X:4573372..4698591 ;4825473..4825859 (4C12-4D2;4D7)
Dp(1;Y)BSC168   X:4573372..4698591 ;4825473..4825859 (4C12-4D2;4D7)
Dp(1;Y)BSC169   X:4698591..4813070 ;4825473..4825859 (4D2-4D6;4D7)
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference