Generating Dp(1;Y)BSC170 and Dp(1;Y)BSC171 Kim Cook, Russell Garton, Adam Brown, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook Bloomington Drosophila Stock Center Indiana University Dp(1;Y)BSC170 and Dp(1;Y)BSC171 were isolated in the screen described in Cook et al. (2010) "Generating Y-linked X chromosome duplications for region 8A to 8F" (/reports/FBrf0210622.html). In that report, we said that stocks of four Dp(1;Y) chromosomes were too unhealthy to be maintained, so the chromosomes were not characterized. Subsequently, we were able to establish healthy stocks of two of these Dp(1;Y)s. The two duplications, their breakpoints are Dp(1;Y)BSC170 X:8483158..8582193 ;9580686 (7F7-8A2;8F9) Dp(1;Y)BSC171 X:8582193..8608364 ;9580686 (8A2-8A2;8F9) The mapping of the Dp(1;Y)BSC170 breakpoints involved an insertion and PCR primer pair not listed in FBrf0210622 : Insertion: P{EPgy2}EY19827 Forward primer: GGACCACTATTCGTAAACCAAAATGTGC ( X:8483158..8483134 ) Reverse primer: CGCTGTGGGCTGCGAGCCGTGTAGC ( X:8483158..8483134 )
