Open Close
Reference
Citation
Cook, K., Garton, R., Brown, A., Ward, M., Deal, J., Kaufman, T., Cook, K. (2010.10.12). Basal X chromosome segments present on Dp(1;Y)BSC chromosomes. 
FlyBase ID
FBrf0212099
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
Basal X chromosome segments present on Dp(1;Y)BSC chromosomes
Kim Cook, Russell Garton, Adam Brown, Megan Ward, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook
Bloomington Drosophila Stock Center
Indiana University
We have generated Y-linked duplications of X chromosomal segments by irradiating an attached-XY (C(1;Y)N12) with an inversion in the X chromosome. Irradiation produces a Dp(1;Y) chromosome by inducing a large deletion in the progenitor chromosome with one breakpoint within the inversion and another breakpoint in X heterochromatin or basal X euchromatin. The region distal to the deletion on a Dp(1;Y) consists of two parts: X tip genes distal to the inversion and genes from the middle of the X moved near the end of the X by the inversion. The distal and medial duplicated segments present on particular Dp(1;Y)BSC chromosomes have been described in other personal communications to FlyBase. 
The region of a Dp(1;Y) proximal to the deletion will carry no basal euchromatic genes if the proximal deletion breakpoint falls in X heterochromatin. When the proximal deletion breakpoint falls in basal X euchromatin, however, basal euchromatic genes will be present. This personal communication describes the basal X segments present on a group of Dp(1;Y)s.
We mapped the distal extents of the basal segments to ~10 gene intervals defined by PCR primers using the following approach. Males carrying a Dp(1;Y) were crossed to females carrying a transposable element insertion in a basal X position. Primers flanking the insertion sites of the transposable elements were used to amplify fragments from DNA isolated from male progeny. With short extension times, fragments are amplified only if the site of the transposable element insertion is present on the Dp(1;Y). The following transposable elements and primer pairs were used in mapping:
Insertion: P{SUPor-P}KG10095
Forward primer: GCATTGCCGACCTTTGAGCTGTGC ( X:20631444..20631467 )
Reverse primer: GTTAAACCTGAATTGAGCATTGCTAGC ( X:20632215..20632241 )
Insertion: P{SUPor-P}KG06210
Forward primer: GTGGATATGGATGTGTGGCAGG ( X:20795940..20795961 )
Reverse primer: CTCCAATCCCACTTCCCTTTGTTGC ( X:20796429..20796453 )
Insertion: P{SUPor-P}bvesKG09159
Forward primer: GATCACTGACAGCTCAATTAGCACTG ( X:20942269..20942294 )
Reverse primer: CATTCGCACTCGAGAGCCATTGAACC ( X:20943012..20943037 )
Insertion: P{GT1}BG02205
Forward primer: CTTGCATGTCCAACAACTTTACAGCC ( X:21075861..21075886 )
Reverse primer: GTGATTGGTTGTTGTGTAAATGGGCC ( X:21076293..21076318 )
Insertion: P{SUPor-P}CG33713KG06423
Forward primer: CTCGTTCTCGATCTTCTCCAGCGCGG ( X:21189930..21189955 )
Reverse primer: GCAGCTTATGCTTACTAGACATCAGCG ( X:21190646..21190672 )
Insertion: P{SUPor-P}slgAKG07965
Forward primer: CCTTTGCAGCTGCAACTGTCCGAGG ( X:21253567..21253591 )
Reverse primer: CGGCTGGAAGTAAGTCTGCTCCG ( X:21254094..21254116 )
Insertion: P{EPgy2}EY09781
Forward primer: CGCACAGGTCTTGAAGGCATTGCC ( X:21443126..21443149 )
Reverse primer: GTTTCTAGCAGCCCCCTTCGCACCG ( X:21443688..21443712 )
Insertion: P{Mae-UAS.6.11}CG14619GG01842
Forward primer: CATCGCTCGCGCGCACAATCTCGGC ( X:21858117..21858141 )
Reverse primer: GTGCCGCCAGGCTGTCTACGCTCC ( X:21858613..21858636 )
Insertion: P{GT1}BG01274
Forward primer: CTAGTGTATTTGCCTTCACCATAATCG ( X:21961730..21961756 )
Reverse primer: GAGCGAGGAATATCTGATATGCGG ( X:21962214..21962237 )
Insertion: PBac{WH}f02323
Forward primer: GATGGCGGTGTCCTTGTCTCTGGC ( X:22366703..22366726 )
Reverse primer: CCTGTGACATTAATGCAGGCGACGG ( X:22367213..22367237 )
The following basal segments are present on Dp(1;Y)s (Release 5 coordinates and predicted cytologies).  These Dp(1;Y)s carry basal euchromatic genes: 
Dp(1;Y)BSC21   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC22   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC29   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC30   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC31   X:20631444--20795940 ;h28--h29 (19E2--19E5;h28--h29)
Dp(1;Y)BSC39   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC43   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC47   X:21189930--21253567 ;h28--h29 (19F4--20A1;h28--h29)
Dp(1;Y)BSC52   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC53   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC54   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC60   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC64   X:21075861--21189930 ;h28--h29 (19F2--19F4;h28--h29)
Dp(1;Y)BSC71   X:21075861--21189930 ;h28--h29 (19F2--19F4;h28--h29)
Dp(1;Y)BSC72   X:20795940--20942269 ;h28--h29 (19E5--19E7;h28--h29)
Dp(1;Y)BSC85   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC90   X:20942269--21075861 ;h28--h29 (19E7--19F2;h28--h29)
Dp(1;Y)BSC100   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC105   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC109   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC118   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC120   X:21189930--21253567 ;h28--h29 (19F4--20A1;h28--h29)
Dp(1;Y)BSC136   X:21858117--21961730 ;h28--h29 (20C1--20C3;h28--h29)
Dp(1;Y)BSC140   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC143   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC149   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC152   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC156   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
Dp(1;Y)BSC169   X:21443126--21858117 ;h28--h29 (20A3--20C1;h28--h29)
PBac{WH}f02323, an insertion immediately distal to stnA in 20F3, was the most basal transposon insertion site we tested by PCR.  The following Dp(1;Y)s do not carry this insertion site and, consequently, do not duplicate basal euchromatic genes distal to stnA. 
Dp(1;Y)BSC11
Dp(1;Y)BSC13	
Dp(1;Y)BSC14	
Dp(1;Y)BSC15	
Dp(1;Y)BSC16	
Dp(1;Y)BSC17	
Dp(1;Y)BSC18	
Dp(1;Y)BSC19
Dp(1;Y)BSC20
Dp(1;Y)BSC23
Dp(1;Y)BSC24
Dp(1;Y)BSC25
Dp(1;Y)BSC26
Dp(1;Y)BSC27
Dp(1;Y)BSC28
Dp(1;Y)BSC33
Dp(1;Y)BSC34
Dp(1;Y)BSC35
Dp(1;Y)BSC36
Dp(1;Y)BSC37
Dp(1;Y)BSC38
Dp(1;Y)BSC41
Dp(1;Y)BSC42
Dp(1;Y)BSC44
Dp(1;Y)BSC45
Dp(1;Y)BSC46
Dp(1;Y)BSC48
Dp(1;Y)BSC49
Dp(1;Y)BSC50
Dp(1;Y)BSC51
Dp(1;Y)BSC55
Dp(1;Y)BSC56
Dp(1;Y)BSC57
Dp(1;Y)BSC59
Dp(1;Y)BSC61
Dp(1;Y)BSC63
Dp(1;Y)BSC65
Dp(1;Y)BSC66
Dp(1;Y)BSC67
Dp(1;Y)BSC68
Dp(1;Y)BSC69
Dp(1;Y)BSC70
Dp(1;Y)BSC73
Dp(1;Y)BSC74
Dp(1;Y)BSC75
Dp(1;Y)BSC76
Dp(1;Y)BSC77
Dp(1;Y)BSC78
Dp(1;Y)BSC79
Dp(1;Y)BSC80
Dp(1;Y)BSC81
Dp(1;Y)BSC82
Dp(1;Y)BSC83
Dp(1;Y)BSC84
Dp(1;Y)BSC86
Dp(1;Y)BSC87
Dp(1;Y)BSC88
Dp(1;Y)BSC89
Dp(1;Y)BSC101
Dp(1;Y)BSC102
Dp(1;Y)BSC104
Dp(1;Y)BSC106
Dp(1;Y)BSC107
Dp(1;Y)BSC108
Dp(1;Y)BSC110
Dp(1;Y)BSC111
Dp(1;Y)BSC112
Dp(1;Y)BSC113
Dp(1;Y)BSC114
Dp(1;Y)BSC115
Dp(1;Y)BSC116
Dp(1;Y)BSC117
Dp(1;Y)BSC121
Dp(1;Y)BSC122
Dp(1;Y)BSC123
Dp(1;Y)BSC124
Dp(1;Y)BSC126
Dp(1;Y)BSC127
Dp(1;Y)BSC128
Dp(1;Y)BSC129
Dp(1;Y)BSC130
Dp(1;Y)BSC131
Dp(1;Y)BSC132
Dp(1;Y)BSC133
Dp(1;Y)BSC134
Dp(1;Y)BSC135
Dp(1;Y)BSC137
Dp(1;Y)BSC138
Dp(1;Y)BSC139
Dp(1;Y)BSC141
Dp(1;Y)BSC142
Dp(1;Y)BSC144
Dp(1;Y)BSC145
Dp(1;Y)BSC146
Dp(1;Y)BSC148
Dp(1;Y)BSC150
Dp(1;Y)BSC151
Dp(1;Y)BSC153
Dp(1;Y)BSC154
Dp(1;Y)BSC155
Dp(1;Y)BSC157
Dp(1;Y)BSC158
Dp(1;Y)BSC159
Dp(1;Y)BSC160
Dp(1;Y)BSC161
Dp(1;Y)BSC162
Dp(1;Y)BSC163
Dp(1;Y)BSC164
Dp(1;Y)BSC165
Dp(1;Y)BSC167
Dp(1;Y)BSC168
Dp(1;Y)BSC170
Dp(1;Y)BSC171
Dp(1;Y)BSC172
Dp(1;Y)BSC173
Dp(1;Y)BSC174
Dp(1;Y)BSC175
Dp(1;Y)BSC176
Dp(1;Y)BSC177
Dp(1;Y)BSC178
Dp(1;Y)BSC179
Dp(1;Y)BSC180
Dp(1;Y)BSC181
Dp(1;Y)BSC182
Dp(1;Y)BSC185
Dp(1;Y)BSC186
Dp(1;Y)BSC187
Dp(1;Y)BSC188
Dp(1;Y)BSC189
Dp(1;Y)BSC192
Dp(1;Y)BSC193
Dp(1;Y)BSC194
Dp(1;Y)BSC195
Dp(1;Y)BSC196
Dp(1;Y)BSC197
Dp(1;Y)BSC198
Dp(1;Y)BSC203
Dp(1;Y)BSC204
Dp(1;Y)BSC205
Dp(1;Y)BSC206
Dp(1;Y)BSC207
Dp(1;Y)BSC208
Dp(1;Y)BSC209
Dp(1;Y)BSC210
Dp(1;Y)BSC212
Dp(1;Y)BSC213
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Aberrations (175)