FB2026_03 , released September 17, 2026
Reference Report
Open Close
Reference
Citation
Cook, K., Garton, R., Brown, A., Deal, J., Deal, M., Kaufman, T., Cook, K. (2011.2.17). Generating Y-linked X chromosome duplications for region 1A to 2C. 
FlyBase ID
FBrf0213104
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
Generating Y-linked X chromosome duplications for region 1A to 2C
Kim Cook, Russell Garton, Adam Brown, Jennifer Deal, Megan Deal, Thom Kaufman & Kevin Cook
Bloomington Drosophila Stock Center
Indiana University
We have generated a set of Y-linked duplications of X chromosomal segments by irradiating an attached-XY with an inversion in the X chromosome. The progenitor C(1;Y)N12, In(1)BSC1, P{w+mC=3'.RS5+3.3'}BSC1 w1118, BS chromosome has the following form:
1Lt to 1B5|2B17 to 1B5|2B17 to X heterochromatin breakpoint distal of bb|YS to YL|BS
In(1)BSC1 is described in FBab0046090 and its construction was described in FBrf0209647. P{w+mC=3'.RS5+3.3'}BSC1  is associated with the distal inversion breakpoint.  
Large irradiation-induced deletions within this progenitor chromosome with one breakpoint within the inversion and one breakpoint in X heterochromatin or basal X euchromatin produce Dp(1;Y) chromosomes of the form:
1Lt to 1B5|2B17 to breakpoint|basal X breakpoint to X het breakpoint distal of bb|YS to YL|BS
These Dp(1;Y) chromosomes all share the same distal 1Lt to 1B5 segment containing the yellow (y) gene. The medial segments of these Dp(1;Y) chromosomes share a common end derived from the inversion breakpoint at 2B17, but they extend different distances distally on the standard X map. The Dp(1;Y) chromosomes carry segments of different sizes from the base of the X.  The breakpoints typically lie in basal X heterochromatin, but they may lie in basal euchromatin.  Dp(1;Y) chromosomes with breakpoints in YS cannot be established in stock, because deletion of YS male fertility genes renders males sterile. The BS-marked tip of YL in C(1;Y)N12 carries a portion of the base of the X distal to bb.   From Comparative Genome Hybridization microarrays of chromosomes derived from C(1;Y)N12 performed by Eric Spana at Duke University, we determined that the distal breakpoint of the basal X segment lies between Release 5 coordinate  X:22228492  in fog and coordinate  X:22384175  in stnA and that genes proximal to stnA are duplicated. We could not determine the proximalmost extent of this segment, but the microarrays indicated that the duplicated segment extends at least to coordinate  X:22416503  in CG13865.  We saw no evidence for a large duplicated segment encompassing the BarH1 and BarH2 genes in 16A, but the resolution of the microarrays is not high enough to exclude the possibility of a small duplicated segment from the region.
Irradiation-induced deletions in the C(1;Y)N12, In(1)BSC1, P{w+mC=3'.RS5+3.3'}BSC1 w1118, BS chromosome can also lie proximal to In(1)BSC1. When this occurs, the inversion lies completely within the distal duplicated segment:  
1Lt to 1B5|2B17 to 1B5|2B17 to breakpoint|basal X breakpoint to X het breakpoint distal of bb|YS to YL|BS
Otherwise, these Dp(1;Y) chromosomes are similar to those arising from deletions with distal breakpoints within In(1)BSC1.  
We exposed C(1;Y)N12, In(1)BSC1, P{w+mC=3'.RS5+3.3'}BSC1 w1118, BS males lacking a free Y chromosome to ~4500 rads in a 137Cs irradiator and mated them to winscy females. Dp(1;Y) chromosomes were recovered in y+ w+ BS males. Stocks were established by crossing these males to winscy females.  47 independent Dp(1;Y) chromosomes were established in stocks from approximately 531,000  progeny screened.   18 of the 47 Dp(1;Y) chromosomes are described here.
We maintained the isogenic background of the DrosDel transposon collection in generating the progenitor C(1;Y)N12, In(1)BSC1 chromosome and in all the Dp(1;Y) screen crosses.  Only the proximal regions of the X chromosome and the Y chromosome of C(1;Y)N12 were introduced from a different genetic background.  Fourth chromosomes were not tracked.  
The distal 1Lt to 1B5 segment shared by all these duplications extends proximally to Release 5 coordinate  X:387562 , the insertion site of P{RS3)CB-5805-3 used in the construction of In(1)BSC1.
The distal extents of the basal duplicated segments were determined by the positions of the proximal irradiation-induced breaks.  We did not map these breakpoints.  We cannot exclude the possibility that genes from the base of the X chromosome are present in the basal duplicated segments.
The proximal end of In(1)BSC1 lies at Release 5 coordinate  X:1837325 , the insertion site of P{RS5}CG36005-HA-1598 used in its construction.
The distal irradiation-induced breaks were mapped to ~10 gene intervals defined by PCR primers using the following approach. Males carrying the new Dp(1;Y) chromosomes were crossed to females carrying a transposable element insertion in the 1B to 2C region. Primers flanking the insertions sites of the transposable elements were used to amplify fragments from DNA isolated from male progeny. With short extension times, fragments are amplified only if the site of the transposable element insertion is present in the Dp(1;Y) chromosome.  Breakpoints were mapped to successively smaller intervals in iterative rounds of crosses and PCR amplifications. The following transposable elements and primer pairs were used in mapping:
Insertion: P{SUPor-P}KG03442
Forward primer: GGTAATGTATGGTGGTGTGGTGTGG ( X:387630..387654 )
Reverse primer: CTGTCCACACTGCGTTCCAGG ( X:388351..388371 )
Insertion: Mi{ET1}MB02961
Forward primer: CACCCGCACTCACTGATGG ( X:475468..475486 )
Reverse primer: GGAGAAACGGAATCAGGCAACC ( X:476241..476262 )
Insertion: P{EPgy2}DreddEY08404
Forward primer: GATGGACATGCAGCGTGATCC ( X:529052..529072 )
Reverse primer: CGACTTAAACGAACTAGAGGTGTGG ( X:529916..529940 )
Insertion: P{SUPor-P}KG03204
Forward primer: GATTCATAGACCCTAACCGTTTCC ( X:649716..649739 )
Reverse primer: CATCGAGTGGTTGCATGATGC ( X:650457..650477 )
Insertion: PBac{WH}f02375
Forward primer: CAATGCATCTGGGCGCCAGG ( X:699748..699767 )
Reverse primer: GTGAAGTTTGTGTCCGGTCGTCC ( X:700347..700369 )
Insertion: Mi{ET1}CG3711MB12128
Forward primer: GAATGTTACTCAGGATCAATACTGGC ( X:818670..818695 )
Reverse primer: CCGCGGACCCATGTTGGAGG ( X:819489..819508 )
Insertion: P{SUPor-P}CG18823KG01298
Forward primer: GGCCTGTGAGAATTAGATACCAGCC ( X:884426..884450 )
Reverse primer: GTTGGTGAGTCGTTCTTCCAGG ( X:885149..885170 )
Insertion: P{EPgy2}EY02876
Forward primer: CAACCAGAACACCACTAAGCGG ( X:926801..926822 )
Reverse primer: CACGGCAGTATCGAGAAGTGC ( X:927283..927303 )
Insertion: P{SUPor-P}KG01655
Forward primer: GACCTGTGAGCCATCGTCGC ( X:1055741..1055760 )
Reverse primer: GCTTAGTGGAGTTCGGATTAGGCC ( X:1056568..1056591 )
Insertion: PBac{RB}CG11378e03299
Forward primer: GGATGGCCAAGTTCCGGACC ( X:1066300..1066319 )
Reverse primer: GCATTACGCACGATAAGTCCGC ( X:1067198..1067219 )
Insertion: P{EPgy2}EY11509
Forward primer: GAATGCCAAGAGAGCAGCATGGC ( X:1103871..1103893 )
Reverse primer: CCTTGAAGTGACTGGGGTAATCGG ( X:1104395..1104418 )
Insertion: P{EPgy2}CG11412EY10202
Forward primer: GCCGATAGTCACAGTTGGC ( X:1236080..1236098 )
Reverse primer: CCAAGCGGCCGAGCCTCCTGC ( X:1236761..1236781 )
Insertion: P{EPgy2}CG3719EY14694
Forward primer: CGATGATTGCAAATTCTGCCTCGGC ( X:1272985..1273009 )
Reverse primer: CCGGCAGCCGCAGGTCC ( X:1273577..1273593 )
Insertion: P{SUPor-P}KG09204
Forward primer: GATTCGGATGCGTAACACAGGC ( X:1274399..1274420 )
Reverse primer: GTGGCAGGACACTCGTGGCCG ( X:1275173..1275193 )
Insertion: P{EP}CG14777G1158
Forward primer: GAGGGCGTGAGATGCGGACG ( X:1360823..1360842 )
Reverse primer: CTGAAACTGCACGATGAGTGG ( X:1361546..1361566 )
Insertion: Mi{ET1}Nmdar2MB09441
Forward primer: CTGCCATTCATAAGGATGAGCAGC ( X:1381640..1381663 )
Reverse primer: GCTTAGGACGACTTTGTGGTGC ( X:1382522..1382543 )
Insertion: P{EPgy2}EY03391
Forward primer: CATCAACTCGCGCGTATCTATGG ( X:1563016..1563038 )
Reverse primer: GGGCGGTTCTGCAGGCTCG ( X:1563763..1563781 )
Insertion: P{GT1}AdarBG02235
Forward primer: CCGCATCGAGGAACCAAATCG ( X:1667892..1667912 )
Reverse primer: GCAATGCAGCAGTGAAGCCTTTCCC ( X:1668680..1668704 )
Insertion: P{SUPor-P}deltaCOPKG07426
Forward primer: GCCAGCAGTCATCAGCTTGGG ( X:1755327..1755347 )
Reverse primer: GTTGGTAAAGGCGATGCTTGG ( X:1756095..1756115 )
Insertion: P{EPgy2}CG14806EY15916
Forward primer: CCGATTGCGTGTCACGAACAGGG ( X:1774273..1774295 )
Reverse primer: GCAGGCGGATGAAGTCTTCC ( X:1775058..1775077 )
Insertion: P{SUPor-P}CG3600KG00928
Forward primer: CTTTGGCCGCCAGGACCGTCC ( X:1841903..1841923 )
Reverse primer: GTGGCTTCGTATTGCAACTCG ( X:1842697..1842717 )
Insertion: P{SUPor-P}KG06944
Forward primer: CAGAAGAACACCAACTAAACTAAACGC ( X:1903879..1903905 )
Reverse primer: GTCTCCTCTTTTCGTCATTGCAGCG ( X:1904294..1904270 )
Insertion: P{EPgy2}CG14054EY07071
Forward primer: CCGCTGTCCTCCTGTCCGCTCGC ( X:1959038..1959060 )
Reverse primer: GTGGACTGCCTGGCGCTTGTGTCC ( X:1959591..1959568 )
The  Dp(1;Y) chromosomes derived from deletion breakpoints within In(1)BSC1 carry the following duplicated segments in addition to the common 1Lt;1B5 segment and any duplicated basal segments (Release 5 coordinates and predicted cytologies): 
Dp(1;Y)BSC299   X:475468..529052 ;1837325 (1B10-1B13;2B17)
Dp(1;Y)BSC300   X:529052..649716 ;1837325 (1B13-1C4;2B17)
Dp(1;Y)BSC301   X:649716..699748 ;1837325 (1C4-1C5;2B17)
Dp(1;Y)BSC302   X:818670..884426 ;1837325 (1D2-1D4;2B17)
Dp(1;Y)BSC303   X:926801..1066300 ;1837325 (1E1-1E3;2B17)
Dp(1;Y)BSC304   X:1103871..1236080 ;1837325 (1E4-1F3;2B17)
Dp(1;Y)BSC305   X:1103871..1236080 ;1837325 (1E4-1F3;2B17)
Dp(1;Y)BSC306   X:1103871..1236080 ;1837325 (1E4-1F3;2B17)
Dp(1;Y)BSC307   X:1274399..1360823 ;1837325 (2A1-2A4;2B17)
Dp(1;Y)BSC308   X:1360823..1381640 ;1837325 (2A4-2B1;2B17)
Dp(1;Y)BSC309   X:1381640..1563016 ;1837325 (2B1-2B5;2B17)
Dp(1;Y)BSC310   X:1563016..1667892 ;1837325 (2B5-2B9;2B17)
Dp(1;Y)BSC311   X:1563016..1667892 ;1837325 (2B5-2B9;2B17)
Dp(1;Y)BSC312   X:1667892..1755327 ;1837325 (2B9-2B13;2B17)
The  Dp(1;Y) chromosomes derived from deletion breakpoints proximal to In(1)BSC1 carry the following duplicated segments in addition to any duplicated basal segments (Release 5 coordinates and predicted cytologies).  In(1)BSC1 lies entirely within the duplicated segments: 
Dp(1;Y)BSC296   X:1 ;1903879..1959038 (1Lt;2C1-2C8)
Dp(1;Y)BSC297   X:1 ;1841903..1903879 (1Lt;2B17-2C1)
Dp(1;Y)BSC298   X:1 ;1841903..1903879 (1Lt;2B17-2C1)
Where coordinate  X:1  represents the X telomere (1Lt).
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference