Tamas Lukacsovich in our lab has determined by inverse PCR that the location of the P{w+mC=tubP-GAL80ts}9 insert in Bloomington stock 7016 is in 6F5, within an intron of the Sxl gene. Similarly, the P{w+mC=UAS- mCD8::GFP.L }LL4 insert in Bloomington stock 5146 has been determined to be in 4D7. Please see the flanking sequences below, and the attached maps:
Here are the flanking sequences (the {P} labels the insertion point):
#7016
GAAAAAAAAAAGAAAAAACAAAGTGTAAGC{P}CAGGCGCGTGAATCGCCTTGCAAGTGTGTGC
#5146
GAGCAGCAGCCCGAAGGTAACCCTCTTTACAC{P}ACCCAACTAAATCCTTAATTTCCCAAGCGTT
I am Brett Barbaro, a graduate student in the lab of J. Lawrence Marsh at University of California, Irvine. The sequencing was done by Tamas Lukacsovich.