The Exelixis insertion d03231 (FBti0042793) has no flanking sequence submitted to GenBank, but I found a 21 bp 5' flank in the GDP database that was imported from the data sent to Roger Hoskins by Exelixis. It is trimmed by the 5' end of the P element on one end and the restriction site of the enzyme used for inverse PCR on the other end. The sequence is:
5' GATCGTTTCGTTCGTTTGGGT 3'
By convention, the 3' end of this 5' flank sequence is the end that abuts the 5' end of the P element.
This sequence aligns 21/21 bp to the release 6 assembly of the reference genomic sequence and the insertion site maps to  X:10086569 (+). This site is within exon 1 of the 5' UTR of the RhoU gene.
This localization also corresponds to the right endpoint of Df(1)BSC712 (FBab0045781), that was generated by FRT recombination with d03231.