Koh, H. (2018.1.31). Location data for P{EP}Idh[GE9298].
FlyBase ID
FBrf0237931
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
The P{EP}IdhGE9298 P-element is inserted at 3L:8357764 <up>Drosophila melanogaster chromosome 3L (AE014296.5)</up>
The adjacent sequence is: 8357764AACCGCGATAAAACCGAGGACCAGGT8357739.
DOI
Related Publication(s)
Research paper
Isocitrate protects DJ-1 null dopaminergic cells from oxidative stress through NADP+-dependent isocitrate dehydrogenase (IDH).
Yang et al., 2017, PLoS Genet. 13(8): e1006975 [FBrf0236533]