Open Close
Reference
Citation
Fukunaga, R. (2019.2.4). Location data for Marf1[null] and Marf1[RL1] deletions. 
FlyBase ID
FBrf0241367
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
Below are the sequences surrounding the junctions in the two alleles Marf1null and Marf1RL1 reported in our paper.
They are both deletions (no insertions or additional nucleotides) in the CDS.
Marf1null
WT allele:   TTTCCCAGCCACC TTAATCTGTACCAATATGTTCG…. ATCGGTAGCTCCAATCGTGGA
Null allele: TTTCCCAGCCACC ATCGGTAGCTCCAATCGTGGA
Deletion of 241 nt
The deletion is predicted to result in a truncated peptide of 103aa, not a 34aa peptide as reported.
Marf1RL1:
WT allele:  TCGATATATCCCC CTTAATGGAAGGACTCC AACATAGTGTTCCTTACTGTAGTATTC
RL1 allele: TCGATATATCCCC AACATAGTGTTCCTTACTGTAGTATTC
Deletion of 17 nt (CTTAATGGAAGGACTCC).
DOI
Related Publication(s)
Research paper

LOTUS domain protein MARF1 binds CCR4-NOT deadenylase complex to post-transcriptionally regulate gene expression in oocytes.
Zhu et al., 2018, Nat. Commun. 9(1): 4031 [FBrf0240268]

Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Alleles (2)
    Genes (1)