Below are the sequences surrounding the junctions in the two alleles Marf1null and Marf1RL1 reported in our paper. They are both deletions (no insertions or additional nucleotides) in the CDS. Marf1null WT allele: TTTCCCAGCCACC TTAATCTGTACCAATATGTTCG…. ATCGGTAGCTCCAATCGTGGA Null allele: TTTCCCAGCCACC ATCGGTAGCTCCAATCGTGGA Deletion of 241 nt The deletion is predicted to result in a truncated peptide of 103aa, not a 34aa peptide as reported. Marf1RL1 WT allele: TCGATATATCCCC CTTAATGGAAGGACTCC AACATAGTGTTCCTTACTGTAGTATTC RL1 allele: TCGATATATCCCC AACATAGTGTTCCTTACTGTAGTATTC Deletion of 17 nt (CTTAATGGAAGGACTCC).