Below are coordinates for the Retko and mavko deletions and details on how they were made:
Retko deletion:  2L:21183166..21189676  (- strand)
mavko deletion:  4:623360..625586  (- strand)
A detailed description of the strategies follows below:
Generation of Retko
A Ret knock-out allele (Retko) was generated using an improved ends-out genomic targeting strategy (Huang et al., 2009). Genomic sequences flanking Ret exons 3-8 (resulting in genetic deletion of Ret  2L:21183166..21189676  (- strand)) were cloned into pRK2 containing a GMR-white cassette and a UAS-rpr cassette (5’ flank: 5kb genomic region  2L:21189677..21194765  (- strand)) and 3’ flank: 3kb genomic region  2L:21180228..21183165  (- strand)). Transgenes were made using standard P-element transformation and lines inserted on the 3rd chromosome were selected and tested for excision efficiency. Ends-out homologous recombination crosses were performed using two independent pRK2-Retko-5’3’ transformants. Negative selection using 2-21-Gal4 (inducing lethality if UAS-rpr was still present) strongly reduced the number of red eyed flies with non-targeting events. Red eyed candidate lines inserted on the 2nd chromosome were validated by PCR using primers flanking the GMR cassette and 5’ and 3’ targeting site in the Ret genomic locus to verify correct gene replacement. Ret ko lines carried a defined replacement of Ret exons 3-8.  Out of three correctly targeted lines, Ret ko line 2.7 was selected for all further experiments based on viability, total loss of anti-Ret immunoreactivity and fully rescuable C4da neuron dendrite phenotypes.
Generation of mavko
A mav knock-out (mavko) allele was generated by CRISPR/Cas9-mediated homology directed repair (HDR) (Gratz et al., 2013; Port et al., 2014). Guide RNAs targeting the 5’ (gRNA: GTTTTCTCCGCATGGCCATT) and 3’ regions (gRNA: GAAGGAGTACAGCATGGACG) of mav coding exons 2 and 3 on the 4th chromosome were cloned into pCFD4 to express both under control of the U6-1 and U6-3 promoter, respectively. A modified pRK2 vector (Huang et al., 2009) lacking the UAS-rpr cassette was used to generate an HDR donor template containing 1kb genomic DNA regions flanking mav coding exons 2/3 (3’ genomic homology  4:622502..623359  (- strand), 5’ genomic homology  4:625587..626729  (- strand)). Both plasmids were co-injected into yw,vasa-Cas9 syncytial embryos to target mav in the germ-line. mavko candidate animals were identified by eye color and correct targeting was verified by PCR analysis. Correct genomic replacement resulted in deletion of mav exons 2 and 3 ( 4:623360..625586  (- strand)). One correctly targeted viable line (no.2) was selected for all subsequent experiments.