Most of this info is in the supplementary information, but I'll make an attempt at presenting this with FlyBase in mind. An annotated version of the reference genome (.gb format, created in Geneious) is in the associated files. deletion Df(3R)Acsx1dL (dL): A CRISPR deletion between guides A2 and C1. Sequence of scarless excision is in Loehlin et al. 2022 supplement. deletion Df(3R)Acsx1dR (dR): A CRISPR deletion between guides B4 and D1. Sequence of scarless excision is in Loehlin et al. 2022 supplement. deletion GluClαdSpc (dSpc): A CRISPR deletion between guides B4 and C1. Sequence of scarless excision is in Loehlin et al. 2022 supplement. deletion Df(3R)Acsx1dLR (dLR): A CRISPR deletion between guides A2 and D1. Retains 3xP3-dsRed marker. deletion Df(3R)Acsx1dLR2 (dLR2): A CRISPR deletion between guides A6 and D5. Retains mini-w marker. Sequences of the guide RNA targets (not including PAM). These should be unique in the reference sequence. >Acsx1-Guide_A2 CAATAACACATCAATGCCGT >Acsx1-Guide_B4 TTTAATATGCTACAGCCCTT >Acsx1-Guide_C1 CAAATCAAGTCAAAGTGTTG >Acsx1-Guide_D1 TAATGTGCTGTACATCCCTT >Acsx1-Guide_A6 CACAAACATCATTATTCTGG >Acsx1-Guide_D5 AGTTCTGAAAACATGCAAGT