Please note that DptBKO was generated by Barajas-Azpeleta et al. (FBrf0240603). We simply isogenized the mutation into the iso DrosDel background.
>DptBKO
AGTAGTTAATATACATATATTATTTTCACAGCTGCCACACATGAATGGATCCCAATCGAAATGCGAGTACCTCTACATTCATTGTTTCTAGATGGGATTCACTTTGGCATCTGCCTCTATTTGAGGAGCCTACACGTACCTCTTATCAACGAAATGTGGGGATCCACTGGTGAACCACTGCACCGTCGTCTTGACAGGGATTCCCAGGATTCGATCTGAGCCTCAACGGACGTGCTCCCGTTTGGCAGAGCCCCAATGGACGCCACTCCTTCGATGCCACGGGATCGTATGCCCAGCACCTTGGTGGACCCTATGGCAACAGCCGGCCTCAGTGGGGAGCCGGTGGAGTGTATACCTTCAGGTTTTAGGGCACTTCAGAAGCTACATAATTTTTATTAAATAAAATAAATTTATTACAATTACAAGTCACTTTTTTTTTTACAAGTATTCAGTTCCAGGTATTGTCCCAGGGTGATGATCCCTTATCAGTTTGATTGTAGGCAAATATTGTGGGATCTGGCTGAGGCATGAAAAACTATAGGGAGAAATACAAAAATGTAACAAATAAAGCAAAACTTAAAGGGCAAAACTAACCTCGTCATCCAAGTTTACAGACCCACCGCCCACAGAACGCCCTTGGATGAGGCCAATTAGGTGGAGAATAAACCAGAGAAGCCACATTTCACCGGGAGAAGCTGCG
Likewise, DptBA3 comes from genetic background line A3 of the DSPR collection of Stuart McDonald (University of Kansas) (https://wfitch.bio.uci.edu/~dspr/RILs/index.html), which is genome-sequenced. To clarify: we did not isogenize the DptBA3 mutation. We did clarify the effect on the DptB coding sequence of DptBA3, which causes a premature stop. I’ve provided fasta sequences below for the genomic region. DptBA3 causes a premature stop, and this is the principle loss-of-function mutation (fasta for DptBA3 below starts from 1st codon of CDS).
>DptBA3
ATGCATTTCACCTCCAGTCTTCTATTCATTGGGCTGGCTTGTGCCTTCTCGAGTGCCTGGGCTTATCCCTATCCTGATCTCCGAGAGATTGTGAATCTGCAGCCTTAACCACTGGCA
A note that Smith et al. (FBrf0257253) also commented on DptBA3 before us in fact, though they simply reported that the locus was aberrant. Specifically, they noted a 37 nucleotide deletion in this strain spanning the end of exon 1 and the intron, expected to cause a failure of splicing. However, when we sequenced the region, we realized co-occurring mutations simply caused a premature stop before even reaching the intron, so we described it as a premature stop.