P{EP}CG34417EP1377 was mobilized in the lab of Nick Brown at the University of Cambridge to produce a deletion within CG34417 called vs17N3-2 that gave a homozygous wing blister phenotype and failed to complement vesiculated (vs) mutations. Whole-genome sequencing of homozygous vs17N3-2 flies by the University of Minnesota Model Organism Sequencing Service in collaboration with the Bloomington Stock Center showed a 3' P element end at the insertion site reported for P{EP}CG34417EP1377 and a 5'P end juxtaposed to coordinate  X:6271388 . The junction sequence at the 3' P end is
TCATCTCAGTCAGACGGCCC|ATGATGAAATAACATAAGGT
and the junction sequence at the 5' P end is
CCTTATGTTATTTCATCATG|GGTGAGATTTGGTGTGCAAC
These results strongly suggest that mobilization of P{EP}CG34417EP1377 resulted in hybrid element insertion between  X:6271387  and  X:6271388  to produce the deletion flanking the 5' proximal end of the P{EP} insertion.
In terms of the reference genome sequence, the deletion has breakpoints  X:6549765--6549766 ; X:6571387--6571388 .
In crosses of females from stocks
vs17N3-2
vs1
y1 pn1 vs148
to males from stock
w1118; Dp(1;3)DC158, PBac{y+mDint2 w+mC=DC158}VK00033/TM6C, Sb1
rescue of the wing-blister phenotype in vs-/Y male progeny by Dp(1;3)DC158 was seen.
These results argue for merging the CG34417 and vs entries under the vs symbol and denoting the intragenic vs17N3-2 deletion as P{EP}vs17N3-2.