3R:6,532,661..6,532,810 [-]
One copy of repeat shown
Sequence
Sequence DownloaderCTACGTGAAGGCGGGCAGCAACGTGGTGCTCCGCTGTATCGTGCGCGGAGCCTTGGAGCCGCCCACGTTCATCATGTGGT ACCACGGCGCCGAGCAGCTGGCGGCCGACTCCCGGCGCCACCGCACGCAACTGGATCCCAACCTGCCGGA
genomic DNA
CTACGTGAAGGCGGGCAGCAA
TCCGGCAGGTTGGGATCCAG
Comprehensive collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene.
NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.
A collection of over 13,200 RNAi transgenes (over 22,200 lines), each designed to target a single protein-coding gene; each construct contains short gene fragments cloned as inverted repeats that are expressed using the binary GAL4/UAS system. It is estimated that 88% of predicted protein-coding genes are targeted.
A specificity score (Q) was calculated for each construct, such that if Q is < 0.5, off-target effects are probable and if Q > 0.8, off-target effects are improbable.