2L:20,736,598..20,737,007 [+]
One copy of repeat shown.
Sequence
Sequence DownloaderGGCTACATTTGCCAGGACATTCGTTTCGGCGTCATGGAGAACCAGTCGAACGATGTGCTGACTGCTATTATTCACGGCAT GAGAAAGGTAGAGCCGAGCAATCATGTACGCTTGGCGGCCACCACGGCCCTTCACAACTCGTTGGAGTTCACCAAATCGA ACTTTGAGAAAGACATGGAGCGCAACTTCATCATGGAGGTGGTGTGCGAGGCCACTCAGTGCCAGGACTCGCAAATCTGC GTTGCCGCTCTGCAGTGCCTGGTGAAGATTATGACCCTTTATTACCAGTACATGGAGCCCTACATGGCACAGGCTCTTTT CCCTATTACTTTGGCGGCCATGAAGTCTGATAACGATGCTGTAGCGCTGCAGGGCATAGAGTTCTGGTCGAACGTCTGCG ATGAGGAGAT
cDNA
AAGAATTCGGCTACATTTGCCAGGACAT
AGTCTAGAATCTCCTCATCGCAGACGTT
Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site.
NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.
A collection of first generation of UAS-driven long RNAi hairpin constructs cloned into derivatives of the VALIUM vector (Vermilion-AttB-Loxp-Intron-UAS-MCS) and targeted into the genome by the phiC31-mediated integration.
The approach used by the TRiP is to generate transgenic animals with an RNAi hairpin under UAS-GAL4 control. The hairpin-containing transgenes are inserted via site-specific recombination into genomic loci known to be optimal for expression. This specific collection was constructed in the pVALIUM10 vector and inserted into the P{CaryP}attP2 target element.
Primers for hairpin constructs were designed using the DRSC amplicon design tool SnapDragon (http://www.flyrnai.org/cgi-bin/RNAi_find_primers.pl). First, regions of 400-600bp that are free of EcoRI and XbaI restriction sites, and free of 19bp predicted off-target sites. If this was not possible, then regions without 20 or 21 bp matches to other genes were used. Primers were used to PCR amplify target DNA. Double-stranded RNA (dsRNA) hairpin constructs were cloned into the VALIUM10 vector, which allows for phiC31 targeted integration into the genome and Gal4-UAS inducible expression. Targeted transgene integration reduces the variability in hairpin expression resulting from random transgene integration.