2L:20,725,904..20,726,305 [-]
One copy of repeat shown.
Sequence
Sequence DownloaderGACTGGTTCTCGAGTTTCTGCCCAGGATTACCGATAAGGTTCTGCTGGCCTGTGTGGCGCCCAAGTTCCGAGCGGCCTTC GAGGGCTGGGCGAGAGTGCAACGAAATGCTTTGGACATGGTTAGTCTGGAGACGGTGCCTCTGCCGCAATTGATCAGGTT CTTCAAGGTGGCGGGACCCTTCATCAGAGTCCTTCAAGTGGACTGTGCGTCCTACCAAAAGGAGTCCCTGCTGGTGGAGT TCGTAAAGGAATACTGCCCCAATCTGGAGGAGATTAGTTACTCGAACGCCACCGATGAGTTTCACTACCGATCGATTATG TCCAAAATGACGCACTTGAAACGGGTGACTATTGAGTGTTTGGATGCAGAGGATGTGCTCAACTTTGATATGCAGCCCAA CC
cDNA
GTCTAGACTGGTTCTCGAGTTTCTGCC
AGAATTCGGTTGGGCTGCATATCAAAG
Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site.
NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.
A collection of first generation of UAS-driven long RNAi hairpin constructs cloned into derivatives of the VALIUM vector (Vermilion-AttB-Loxp-Intron-UAS-MCS) and targeted into the genome by the phiC31-mediated integration.
Primers for hairpin constructs were designed using the DRSC amplicon design tool SnapDragon (http://www.flyrnai.org/cgi-bin/RNAi_find_primers.pl). First, regions of 400-600bp that are free of EcoRI and XbaI restriction sites, and free of 19bp predicted off-target sites. If this was not possible, then regions without 20 or 21 bp matches to other genes were used. Primers were used to PCR amplify target DNA. Double-stranded RNA (dsRNA) hairpin constructs were cloned into the VALIUM vector, which allows for phiC31 targeted integration into the genome and Gal4-UAS inducible expression. Targeted transgene integration reduces the variability in hairpin expression resulting from random transgene integration.
The approach used by the TRiP is to generate transgenic animals with an RNAi hairpin under UAS-GAL4 control. The hairpin-containing transgenes are inserted via site-specific recombination into genomic loci known to be optimal for expression. This specific collection was constructed in the pVALIUM1 vector and inserted into the P{CaryP}attP2 target element.