FB2026_03 , released September 17, 2026
Sequence Feature: Dmel\dsRNA-VSH330188
Open Close
General Information
Symbol
Dmel\dsRNA-VSH330188
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000577132
Collection
Associated gene
Genomic Location
Chromosome (arm)
2L
Sequence location

2L:6,672,653..6,672,673 [-]

Genomic Maps
Sequence Data
Length
21
Comments

Sense strand of short RNA hairpin shown.

TCGAGACACAGCAGAAGTTCA
Associated Information
Gene(s) (targeted or local)
Allele(s)
Transcripts(s)
    Polypeptide(s)
      Construct
      Experimental Data
      Collection Information
      Collection: VDRC-SH
      Symbol
      Title
      A set of transgenic RNAi constructs for expression of shRNA under UAS control, VDRC third generation.
      Source and Progenitors
      Species of derivation
      D. melanogaster
      Strain of derivation
      Vector of progenitor construct
      Description

      A collection of transgenic lines carrying short RNA hairpins (shRNA) cloned into the pWALIUM20 vector for under GAL4-inducible expression. Constructs were integrated into the attP40 genomic landing site. The collection of shRNA is complementary to the DRSC TRiP resource (no overlap).

      Additional data
      Sample preparation
      Collection preparation

      21nt siRNA oligos were designed to target exons common to all isoforms of a gene using the DSIR website tool. Oligos were compared to SNP resequencing data from 10 Drosophila genomes. For each gene, the best siRNA oligo was selected on a combination of highest predicted activity, lowest off-target probability and absence of common SNPs in a critical position. Any shRNAs exactly matching those at the DRSC TRiP resource were eliminated. Each of the siRNA oligos was then incorporated into a 71nt oligo to generate shRNA (short RNA hairpin). This was cloned pWALIUM20 vector to enable GAL4-inducible expression in germline and somatic cells. Constructs were integrated into the attP40 genomic landing site on the left arm of the second chromosome at 25C6, which has been shown to provide high levels of induced expression of transgenes, yet maintain a low basal expression when the transgenes are not induced.

      21nt siRNA oligos were designed to target exons common to all isoforms of a gene using the DSIR website tool. Oligos were compared to SNP resequencing data from 10 Drosophila genomes. For each gene, the best siRNA oligo was selected on a combination of highest predicted activity, lowest off-target probability and absence of common SNPs in a critical position. Any shRNAs exactly matching those at the DRSC TRiP resource were eliminated. Each of the siRNA oligos was then incorporated into a 71bp oligonucleotide to generate shRNA (short RNA hairpin) as follows. A top strand oligo was designed by concatenating "ctagcagt", the sense-strand oligo (21 nucleotides), "tagttatattcaagcata", the anti-sense oligo, and "gcg". A bottom strand oligo was designed by concatenating "aattcgc", the sense-strand oligo,"tatgcttgaatataacta", the anti-sense oligo, and "actg". This 71bp oligonucleotide was cloned pWALIUM20 vector to enable GAL4-inducible expression in germline and somatic cells. Constructs were integrated into the attP40 genomic landing site on the left arm of the second chromosome at 25C6, which has been shown to provide high levels of induced expression of transgenes, yet maintain a low basal expression when the transgenes are not induced.

      Mode of assay
      Data analysis
      Cell lines
      Observed in
      Not observed in
      Comments
      Stocks (1)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      dsRNA-VSH330188
      Secondary FlyBase IDs
        References (1)