UASt regulatory sequences drive expression of the R2-element ORF (this encodes the R2 retrotransposase), carrying mutations that have been shown to result in a nuclease dead protein when the corresponding residues were mutated in the Bombyx mori R2-element retrotransposase. The mutations in the the R2-element ORF are as follows: codons 906-909 (KPD) have been replaced with a single codon (A), and there are two additional amino acid replacements: K938A and R941A. The coding sequence is tagged at the N-terminal end with 3xTag:FLAG. Silent mutations have been introduced into the coding sequence (CCGGTTGAACTCATCAATCAA to ACGTCTTAATAGCAGTATTAA) to render it resistant to RNAi-mediated knockdown by the P{UAS-R2(ORF).RNAi.1} transgene.